Phusion high fidelity dna polymerase

For the reporter construct, the promoter fragment (−1,000 to −1 bp) of bZIP60 was amplified from Col-0 genomic DNA using Phusion High-Fidelity DNA Polymerase (New England BioLabs) with primers tailed with restriction enzyme sites: NotI (forward) and BstXI (reverse). The bZIP60 promoter fragment was cloned into pGEM-T easy vector (Promega). After sequence verification, it was subcloned into pGreenII 0800-LUC through restriction enzyme sites, NotI (forward) and BstXI (reverse), generating the bZIP60 promoter reporter construct. For effector constructs, the CDS of ABI5 was amplified from Col-0 cDNA using Phusion High-Fidelity DNA Polymerase (New England BioLabs) with primers tailed with restriction enzyme sites: NotI (forward) and EcoRI (reverse). After sequence verification, it was subcloned into pGreenII 62-SK through restriction enzyme sites, NotI (forward) and EcoRI (reverse), generating the ABI5 reporter construct. The BiP3 reporter and bZIP28n, sbZIP60 and GBF2 effector constructs were generated in a previous study^{36 (link)}. The created reporter and effector plasmids were introduced into A. tumefaciens strain GV3101 along with pSOUP. Transformed cells were plated on LB agar media with rifampicin (25 μg ml⁻¹), kanamycin (50 μg ml⁻¹) and gentamicin (25 μg ml⁻¹).

TDsmURFP was created using the smURFP homology model (Fig. 1d) and approximating the distance from the C-terminus to the N-terminus of the second subunit. A 23 amino acid linker (GHGTGSTGSGSSGTASSEDNNMA) was sufficient and primers were created with 5’ BamHI and 3’ EcoRI restriction sites (IDT). SmURFP was PCR amplified with Phusion High-Fidelity DNA Polymerase (NEB) to create the right and left subunits using 23 amino acid linker primers. The two products were combined and TDsmURFP was created by bridging PCR with Phusion High-Fidelity DNA Polymerase (NEB). TDsmURFP was digested with BamHI-HF and EcoRI-HF (NEB), gel purified using Zymoclean Gel DNA Recovery Kit (Zymo), and subcloned into a pBAD (Life Technologies) vector containing HO-1 digested with BamHI-HF and EcoRI-HF (NEB) with T4 DNA Ligase (Life Technologies).

cDNA was synthesized via MMLV reverse transcriptase (ThermoFisher Scientific cat. # 28025013) using Random Hexamers (ThermoFisher Scientific cat # N8080127). Competitive PCR was performed via Phusionâ High-Fidelity DNA Polymerase (NEB cat # M0530L) with a 1:1:1 concentration of the following primers: LacZ FWD O/H primers: 5′TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCG TGCCTTCCTTGACCCTG 3′, LacZ RVS uncleaved O/H primers: 5′GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTAGAATGACACCTACTCAGACAA 3′ and LacZ RVS cleaved O/H primers: 5′ GTCTCGTGGGCTCGGAGATGTGTA TAAGAGACAGTTTTTTTTTTTGCGATGCAATTTC 3′ All oligos were purchased from IDT. PCR conditions as follows: 98.0°C for 00:30, 98.0°C for 00:10, 60.0°C for 00:30, 72.0°C for 01:00, 25 cycles and 72.0°C for 00:10. PCR samples were run on Agilent’s Bioanalyzer, DNA1000, and results were analyzed using Bioanalyzer Software, 2100 Expert Software. Percent uncleaved calculated: (uncleaved band molarity) / (sum of cleaved + uncleaved molarity) X 100. See Table S1 for primers.