Quantscript rt kit

Dulbecco’s modified Eagle medium (DMEM) and fetal bovine serum (FBS) were purchased from Gibco (BRL, Gaithersburg, MD, USA). Ox-LDL was purchased from Union-Biology (Beijing, China). DKK-1 and PEDF were obtained from PeproTech (Rocky Hill, NJ, USA). Lithium chloride (LiCl), 3-(4,5-dimethyl-2-thiazolyl)-2,5- diphenyl-2-H-tetrazolium bromide (MTT) dye and 2′,7′-dichlorofluorescin diacetate (DCFH-DA) were purchased from Sigma (St Louis, MO, USA). Annexin V-FITC/propidium iodide (PI) apoptosis detection kits were obtained from KeyGEN Biotech (Nanjing, China). SYTO-13/PI dye was purchased from Life Technologies (Carlsbad, CA, USA). Anti-β-catenin (non-phosphorylated β-catenin) polyclonal antibody, anti-disheveled-1 (anti-Dvl-1) polyclonal antibody and anti-PEDF polyclonal antibody were obtained from Santa Cruz Biotechnology (Santa Cruz, CA, USA). TRIZOL reagent, OPTI-MEM I reduced-serum medium and Lipofectamine 2000 were purchased from Invitrogen (Carlsbad, CA, USA). QuantScript RT kits and RealMaster-Mix (SYBR Green) kits were obtained from Tiangen Biotech (Beijing, China). Lactate dehydrogenase (LDH), malondialdehyde (MDA), superoxide dismutase (SOD) and NO assay kits were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China).

Total nucleic acids were isolated from 200 μL serum using the High Pure Viral Nucleic Acid Kit (Roche Diagnostics) following the manufacturer’s protocol and Quantification of HBV RNAs (Roche Diagnostics). Isolated HBV RNA was reverse transcribed using Quantscript RT Kits (Tiangen Biotech, Beijing, China) with Olige (dT). For detection of the resulting HBV cDNAs, the real-time PCR analyses were performed (ABI Prism 7300 Sequence Detection System (Applied Biosystems, Foster City, CA). A 25-lL volume of reaction mixture containing Taqmen PCR Master Mix (Applied Biosystems), 200 nM of forward primer (5′-GGTCCCCTAGAAGAAGAACTCCCT-3′, nucleotides nt 2361–2384), 200 nM of reverse primer (CATTGAGTTCCCGAGATTGAGAT, nucleotides nt 2425–2448), Taqmen Probe (5′-FAM-TCTCAATCGCCGCGTCGCAGA-TAMRA-3′, nucleotides nt 2402–2422) and 2 uL of cDNA solution was prepared. Amplification was performed after an activation step at 95 °C for 1 min with 40 two-step cycles of 15 s at 95 °C and of 30 s at 60 °C ending with a cooling step down to 4 °C. In parallel, one negative control, one positive control, and a re-calibrator were analyzed. Dilution series of plasmid-based positive controls were used to generate external calibration curves for quantitative analysis. The lower limit of detection was 500 copies/mL.

Total RNA was extracted from cell cultures by using the TRIzol reagent according to the manufacturer's protocol (Invitrogen). RNA was reverse transcribed into cDNA by Quantscript RT Kit (Tiangen). RT-PCR was performed by using primers derived from the human VEGF sequence with SYBR-green dye. The experiment group mRNA levels were calculated as 2^−Δ(ΔCt), where ΔCt = Ct_experiment - Ct_actin and Δ(ΔCt) =ΔCt_experiment –ΔCt_control. The primer sequences are listed in Supplementary Table S1B.