The largest database of trusted experimental protocols

Mouse primary mir 181b2

Manufactured by Thermo Fisher Scientific

Mouse-primary-miR-181b2 is a laboratory reagent used for research purposes. It is a synthetic precursor of the microRNA miR-181b2, which is found naturally in mice. The core function of this product is to provide a source of miR-181b2 for experimental studies involving gene expression and regulation in mouse models.

Automatically generated - may contain errors

2 protocols using mouse primary mir 181b2

1

Quantitative Analysis of miRNA-181b Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
Tissues were homogenized using TissueLyser II (Qiagen) according to manufacturer/s instructions. RNA isolation was using TRIzol Reagent according to the manufacturer’s instructions. Subsequent RT-qPCR was performed using a High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems). For SyberGreen-based assay GoTaq qPCR Master Mix (A6001, Promega) was used, and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to β-actin or U6 (Aglient, AriaMx Real Time PCR System). Specific primers including miR-181b-5p (#001098), U6 (#001973), human-HPRT (Hs05647472_cn), human-primary-miR-181b1 (Hs03302966_pri), human-primary-miR-181b2 (Hs03302963_pri), mouse-HPRT (Mm00522878_cn), mouse-primary-miR-181b1 (Mm03307120_pri) and mouse-primary-miR-181b2 (Mm03307414_pri) were purchased from Life Technologies. Changes in expression were calculated using delta delta Ct method.
+ Open protocol
+ Expand
2

RNA Isolation and RT-qPCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total RNA from intima, PBMCs, and BMCs were isolated using TRIzol Reagent according to the manufacturer’s instructions. Subsequent RT-qPCR was performed using a High-Capacity cDNA Reverse Transcription Kit (4368813, Applied Biosystems). For SyberGreen-based assay, GoTaq qPCR Master Mix (A6001, Promega) was used, and for TaqMan Universal Master Mix II, UNG (4440038, Life Technologies) was used. Expression of mRNAs and miRNA expression were normalized to β-actin or U6 (Aglient, AriaMx Real Time PCR System). Specific primers including miR-181b-5p (#001098), U6 (#001973), snoRNA234 (ID# 001234), human-Hprt (Hs05647472_cn), human-primary-miR-181b1 (Hs03302966_pri), human-primary-miR-181b2 (Hs03302963_pri), mouse-Hprt (Mm00522878_cn), mouse-primary-miR-181b1 (Mm03 307120_pri) and mouse-primary-miR-181b2 (Mm03307414_pri) were purchased from Life Technologies. VE-Cadherin forward primer CACTGCTTTGGGAGCCTTC and reverse primer GGGGCAGCGATTCATTTTTCT were used to detect VE-Cadherin mRNA expression. GAPDH primers are forward AGGTCGGTGTGAACGGATTTG and reverse TGTAGACCATGTAGTTGAGGTCA. Changes in expression were calculated using deltadelta Ct method. Primer sequences are described in (Supplemental Table SII).
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!