Mirna qrt pcr detection kit

Total RNA was isolated using Trizol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. Isolated RNA was measured using a Nanodrop 1000 spectrophotometer (Thermo Scientific, DE, USA) with an OD₂₆₀/OD₂₈₀ ratio greater than 1.8 used for cDNA synthesis. The reverse transcription of miR-101 and its specific amplification were performed using a miRNA qRT-PCR Detection Kit (GeneCopoeia, MD, USA). U6 was used as an endogenous control. cDNA synthesis of VEGF-C was performed using a First-Strand cDNA Synthesis Kit (GeneCopoeia, MD, USA), and the real-time quantitative PCR (RT-qPCR) reaction of VEGF-C was performed using qPCR Mix (GeneCopoeia, MD, USA). GAPDH was used for VEGF-C template normalization. All primers were purchased from GeneCopeia. miR-101 and VEGF-C amplification were determined on a ROTOR-GENE 3000 platform. The target PCR threshold cycle (Ct) values were normalized by subtracting the U6 or GADPH Ct value, which provided the ΔCt value. Relative expression was calculated using the following equation: relative gene expression level = 2 ^{-(ΔCt experimental group-ΔCt control group}).

Total RNA was isolated from GM using TRIzol reagent (Molecular Research Center, Inc) and treated with Turbo DNA-free reagent (Ambion) to reduce DNA contamination. Total RNA concentrations were measured and assessed for purity using a NanoDrop One spectrophotometer (Thermo Fisher). Relative mRNA levels were determined by qPCR using One Step PCR Master Mix Reagents or Two Step PCR Master Mix for TaqMan analysis (Applied Biosystems) after cDNA synthesis by using High-Capacity cDNA Archive reagents (Applied Biosystems). miRNAs were reverse-transcribe using miRNA first-strand cDNA synthesis kit (QP018, Genecopoeia). Semi-quantification of miR-675-3p and miR-675-5p was performed using a miRNA q-PCR detection kit (QP016, Genecopoeia). U6 snRNA, TATA binding protein and Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) mRNAs were measured as normalization controls. The mature mmu-miR-675-3p (cuguaugcccuaaccgcucagu) and -5p (uggugcggaaagggcccacagu) DNA sequences were used as the forward primers, and the universal adaptor PCR primers provided in the miRNA qRT-PCR detection kit (Genecopoeia) as the reverse primer. qPCR primers unless stated here were detected with TaqMan probes.

Glucose-Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), Trizol reagent, miRNA reverse transcription kit, and Lipofectamine 2000 were purchased from Life Technologies (Waltham, MA). BCA protein assay kits were purchased from Beyotime (Haimen, China). Pre-miR-33a-5p lentivirus plasmid, anti-miR-5p lentivirus plasmid, HIF-1α overexpressing plasmid, and HIF-1α shRNA plasmid were purchased from DingGuoChangShengBiotech (Beijing, China). Sequences of the insert in plasmids were listed in Supplementary Table 1. miRNA qRT-PCR Detection Kit was purchased from GeneCopoeia, Rockville, MD, USA. RevertAid^™ H Minus First Strand cDNA Synthesis Kit was purchased from Fermentas. MTT was purchased from Biosharp (Hefei, Anhui, China). The Power SYBR Green kit was purchased from TOYOBO (Osaka, Japan). The glucose assay kit, lactate assay kit, and LDH activity assay kit were from Biovision (Milpitas, CA). The ATP assay Kit was from Beyotime Biotechnology (Shanghai). Mouse anti-HIF-1α monoclonal antibody, mouse anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) monoclonal antibody, and rabbit anti-mouse secondary antibody were purchased from Abcam (Cambridge, UK) and anti-lactate dehydrogenase A (LDH-A) antibody was from Epitomics (Burlingame, CA).

RNA was extracted from BMMs using a RNA isolation kit (Takara) according to the manufacturer’s instructions. A quantitative RT-PCR analysis was performed using the SYBR Green PCR Master Mix (Takara Bio). miR-149-5p in EVs from BMMs supernatant or serum of mice was extracted using the miRNeasy Serum/Plasma kit (QIAGEN). The expression of miR-149-5p was detected with the miRNA qRT-PCR Detection Kit (GeneCopoeia). Levels of each mRNA or miRNA, respectively, were normalized to the GAPDH or U6 levels. The miR-149-5p level of EVs was compared with spiked-in ce-miR-39 to normalize miRNA expression, which was used as the reference by using the miRNeasy Serum/Plasma Spike-In Control kit (QIAGEN). Each experiment was performed at least 3 times. The 2^−ΔΔCT method was used to quantify expression of the genes of interest. The primer sequences used in this study are listed in Supplemental Table 1.

Total RNA of cells was extracted by the RNA isolation kits (Qiagen, Germany). For mRNA detection, cDNA was synthesized by the Quantitect reverse transcription kit (Qiagen). All operations were carried out according to manufacturer’s instructions. The mRNA expression levels of genes were quantified by SYBR Mix (Takara, Japan) and Roche real-time PCR detection system (Roche Diagnostics). The primers used in this study were as follows: KFL12: 5′-CCTCACCTTCTTCAACTTCAAC-3′(F), 5′-GCCTCCAACACCAGATGC-3′(R); KDM5A: 5′-AGGATAGGAAATACCCAGAGAATG-3′(F), 5′-GAGCCACAGAAGCACAGG-3′(R); HHIP: 5′-GTGCTACGGCTGGATGTG-3′(F), 5′-TGGTGCTGTTGAAGTGTGG-3′(R); GAPDH: 5′-CCACTCCTCCACCTTTGAC-3′(F), 5′-CACCACCCTGTTGCTGTAG-3′(R). PCR conditions were as follows: 5 min at 95 °C, followed by 40 cycles of 95 °C for 10 s and 60 °C for 60 s. GAPDH was used as an internal control. For miRNAs detection, cDNA synthesis and quantitative RT-PCR detection were conducted by miRNA qRT-PCR detection kit (GeneCopoeia, Rockville, Maryland). The primers of miRNAs used in this study were designed and synthesized by GeneCopoeia. PCR conditions were as follows: 5 min at 95 °C, followed by 40 cycles of 95 °C for 10 s, 60 °C for 20 s, and 72 °C for 10 s. U6 was used as an internal control. The fold change was calculated according to the formula 2^−ΔΔCt. Each reaction was performed in triplicate.

The RNAs were isolated by TRIzol reagent (Ambion). For mRNA detection, a PrimeScript RT reagent kit (Takara) was used for the DNA synthesis, and quantitative real-time PCR was conducted in triplicate with SYBR Premix Ex Taq (Takara). The primers of mRNAs were synthesized by GenePharma and listed in Table S2. For miRNA detection, a miRNA qRT-PCR Detection Kit (GeneCopoeia) was used for the cDNA synthesis and quantitative detection. GAPDH and U6 were used as internal controls for mRNAs and miR-20a-5p, respectively. The relative expression was calculated by the formula 2^-ΔΔCt.

For the selected circRNAs, total RNAs (3 μg) were employed for first strand cDNA synthesis with dNTP Mix (HyTestLtd), RNase inhibitor (Enzymatics) and SuperScript III Reverse Transcriptase (Thermo Fisher Scientific). The qRT‐PCR was performed on an Applied Biosystems 7500 Fast Real‐Time PCR System (Applied Biosystems) using SYBR Green master mix (Cloudseq). The primers of circRNAs and genes were synthesized by Sangon and shown in Table S2.
The cDNA synthesis and quantitative detection of miRNAs were performed with the miRNA qRT‐PCR Detection Kit (GeneCopoeia). The primer of hsa‐miR‐6817‐5p was designed by GeneCopoeia. U6 was used for normalization. The relative expression was calculated by the formula 2^−ΔΔCt.