Advantage rt pcr kit

For the gene expression analysis, RNA was extracted from the collected mycelia which were finely ground under liquid nitrogen. Purification of RNA was performed using the Qiagen RNeasy PlusMinikit (Qiagen, Hilden, Germany) in accordance with the manufacturer’s recommendations. RNA concentrations were quantified using a Nanodrop 2000 spectrophotometer (Thermo Scientific, Illkirch, France) RNA integrity and purity were checked using the Experion RNA analysis kit and software (version 3.20, 2015, BioRad, Marnes-la-Coquette, France). First-strand cDNA synthesis was carried out with an Advantage RT-PCR kit (Clontech, Saint-Quentin-en-Yvelines, France). In accordance with the manufacturer’s instructions, 1 µg of total RNA was synthesized using an oligo dT (5′-GCTGTCAACGATACGCTATAACGGCATGACAGTGTTTTTTTTTTTTTTT-3′).

Total zebrafish RNA was isolated using TRIzol (Invitrogen, Waltham, MA, USA ). After adding 500 µL of TRIzol to the larvae, 100 µL of chloroform was added, and the solution was mixed and incubated for 5 min. After centrifugation (12,000 rpm, 4 °C, 15 min), the upper phase was transferred to a new tube, and 500 µL of isopropanol was added. After a 10-min incubation period and another centrifugation step (14,000 rpm, 4 °C, 10 min), the supernatant was discarded. The pellet was washed with 1 mL of 70% ethanol and centrifuged (9500 rpm, 4 °C, 5 min). The supernatant was removed, and the pellet was air dried. The pellet was dissolved in 20 µL of DEPC-treated water and incubated on ice for 10 min. The concentration and purity of the total RNA were determined using a NanoDrop device (Thermo Fisher Scientific, Waltham, MA, USA). Reverse transcriptase reactions were used to synthesize cDNA from 2 µg of total RNA using an Advantage RT-PCR kit (Clontech, Palo Alto, CA, USA) following the manufacturer’s protocols. Test gene expression levels were normalized against β-actin levels in each zebrafish larva sample.

We extracted total RNA from the floral buds of P. aphrodite at the B2 developmental stage using Trizol Reagent (Ambion – Berlin, DE) followed by DNase treatment. We reverse-transcribed 500 ng of total RNA using an Advantage RT-PCR kit (Clontech, Mountain View, CA, USA) with oligo dT and random primers.
We designed CUP-specific primer pairs starting with the sequences of P. aphrodite obtained from the in silico analysis (Table 1). We used 30 ng of first-strand cDNA to PCR amplify the transcripts of the CUP genes. We conducted each amplification reaction in a final volume of 50 µL, with the following reagent concentrations: 1X reaction buffer, 0.5 mM of each primer, and 2.5 U Wonder Taq DNA polymerase (Euroclone–Milan, IT). The thermal cycle was the following: 95 °C for 1 min, 35 cycles of 95 °C for 15 s, 57–59 °C for 15 s, and 72 °C for a time ranging from 30 s to 1:30 min, depending on the amplicon size.
We cloned and sequenced the amplicons as described before.

To extract high quality cellular RNA, we packaged the epididymal fat samples with aluminum foil, kept them at −70 °C, and used Mini RNA Isolation IITM (ZYMO Research, CA, USA). The samples were crushed in 300 μL of ZR RNA buffer, and only the supernatant was collected, centrifuged, and washed twice. After adding RNase-free water, we centrifuged the samples at 100 rpm and kept them at −70 °C [17 (link)].
We conducted qRT-PCR on AT samples using a 7900 HT Fast Real-Time PCR System (Applied Biosystems^®, Waltham, MA, USA) to quantify the expression of inflammatory genes, including TNF-α, F4/80, CCL2, C-C motif ligand 4 (CCL4), C-C motif ligand 5 (CCL5), regulated on activation, normal T-cell expressed, and secreted (RANTES)], and CXCR4. In the process of cDNA synthesis using Advantage RT PCR Kit (Clontech, Palo Alto, CA, USA), we cultured 1 μg of RNA, oligo (dT), and RNase-free H₂O mixtures at 70 °C for 2 min, kept them at 42 °C for 60 min, and mixed them with MMLV reverse transcriptase, 5× reaction buffer, recombinant RNase inhibitor, and 10 nM dNTP. We finally conducted RT-PCR with dH₂O, 2× SYBR reaction buffer, and specific primers (Table S2). We set the cycle threshold (Ct) for relative quantitation based on GAPDH using SDS Software 2.4 (Applied Biosystems^®) and adjusted the fold-change assuming that the value of the NC group was 1.

Total RNA was purified using the miRNeasy mini kit (Qiagen, UK) according to the manufacturer’s instructions and was treated with RNase-free DNase. One (1 (link)) µg RNA was used to synthesize cDNA utilizing Advantage RT-PCR kit (Clontech Laboratories, Mountain View, CA, US). Quantitative RT-PCR was performed in triplicate using 4 µl cDNA mixed with 2x FastStart Essential DNA Green qPCR mastermix (Roche, New York, NY, US) and 0.3 µM forward and reverse primers. Amplifications were performed utilizing the LightCycler 96 Real-time PCR detection system (Roche) using the following cycle conditions: 95°C for 10 min (1 cycle); 95°C for 10 sec, 59°C for 20 sec, 72°C for 30 sec (45 cycles). GAPDH expression levels were used for normalization, and gene expression differences were calculated using the threshold cycle (Ct). Three independent experiments were performed for each reaction, and the obtained values were plotted as mean ± SD. The respective primers are:
GAPDH: 5’-GAGTCCACTGGCGTCTTC-3’ and 5’-GGGGTGCTAAGCAGTTGGT-3’
VEGF-A:5’- CCCACTGAGGAG TCCAACAT -3’ and 5’- TGGATGGTGGTACAGTCAGAG C -3’
IL-8: 5’- GAT CCACAAGTCCTTGTTCCA -3’ and 5’- GCT TCCACATGTCCTCACAA -3’

RNAlater-preserved surgical specimens were homogenized with a Mixer Mill MM300 homogenizer (Qiagen). Total RNA from tissues was isolated using RNeasy Mini kits (Qiagen) according to the manufacturer’s instructions. cDNA was synthesized from 1.0 µg total RNA using an Advantage RT PCR-kit (Clontech Laboratories Inc., Mountain View, CA, USA).