Purelink quick gel extraction kit

SA RNA preparations were performed using the hot-phenol method [20 (link)] followed by treatment with amplification grade DNAse I (Thermo Fisher Scientific, Waltham, MA, USA), or using Direct-zol RNA MicroPrep w/ TRI Reagent kits (Zymoresearch, Irvine, CA, USA). BA RNA preparations were performed by adding 25 µL of “lysis mix” (a mixture of 200 µL of 10% SDS and 50 µL of 0.5 M EDTA), 5-min incubation at 99 °C, followed by the hot-phenol method [20 (link)]. Total bacterial RNAs amount and integrity was QCed (Quality Controlled) by absorbance readings using a Nanodrop spectrophotometer and by observation of rRNAs on 0.8% agarose gels stained with ethidium bromide. Phage K DNA preparations were made by proteinase K treatment followed by phenol/chloroform extraction as indicated previously [19 (link)]. Nucleic acid integrity was evaluated by gel electrophoresis in ethidium bromide agarose gels. The1 kb plus DNA ladder (Thermo Fisher Scientific) was used as a size marker. DNA band isolation was done using the Purelink quick gel extraction kit (Thermo Fisher Scientific). Sanger sequencing was done by MacrogenUSA using the oligos OK1-F and SeqI2-F, and the resulting peaks were visualized using opensource ApE plasmid editor software [21 ].

16S rRNA region was amplified for all the β hemolysin–positive isolates using the primers as described by Dorsch, Ashbolt, Cox, and Goodman (1994), and A. hydrophila ATCC 7966 strain was used as the positive control. Briefly, genomic DNA was extracted from β hemolysin–positive isolates using Bacterial Genomic DNA Purification Kit (HiMedia, Mumbai, India). Quality and quantity of genomic DNA were measured using Nanodrop™ (Thermo Fisher Scientific) and resolved using 0.7% agarose gel electrophoresis. Details of the primers and their product size are provided in Table 1. 16S rRNA gene was amplified using SureCycler 8,800 Thermal Cycler (Agilent Technologies), and the PCR product was eluted using PureLink™ Quick Gel Extraction Kit (Thermo Fisher Scientific). The eluted PCR product was cloned into TA cloning vector pXcmKn12 (Thermo Fisher Scientific) and transformed into Escherichia coli DH5‐α. Transformants were selected on Luria Bertani (LB) agar ampicillin (50 µg/ml) plate by Blue‐white selection method and confirmed by colony PCR. All the clones were sequenced in automated DNA sequencer (Xcelris Labs Limited, Ahmedabad, India).

To investigate the distribution of fungal endophytes between C. songaricum and N. tangutorum, genomic DNA of surface-sterilized CSR, SNT, and NT was extracted with Plant DNA Mini Kit (Omega Bio-Tek, Doraville, GA, United States) following manufacturer’s instructions.
PCR amplification of the internal transcribed spacer region 2 (ITS2) in rRNA gene regions were performed using primer pairs ITS3F: GCATCGATGAAGAACGCAGC and ITS4: TCCTCCGCTTATTGATATGC. The PCR reaction system (25 μL) contained 1 μL of each primer (10 μM), 2 μL of template (50–100 μg/μL), 1 μL of dNTP (10 mM), 0.2 μL of TaqDNA Polymerase (5 U/μL), 2.5 μL of 10× buffer, 17.3 μL of ddH₂O. PCR reactions were carried out as follows: 3 min of initial denaturation at 94°C, followed by 40 cycles of: 94°C for 30, 47°C for 30 s, and 72°C for 45 s; and final extension of 7 min at 72°C. PCR products were recovered from agarose gels using PureLink Quick gel extraction Kit (Thermo Fisher Scientific, United States) according to the manufacturer’s instructions. After quantification of DNA concentration using Nanodrop ND-1000 with software ver.3.3 (Thermo Scientific, United States), all PCR products were sent for high-throughput amplicon sequencing (in triplicates) using the Illumina Miseq platform (United States) at the Services Facility (Sangon Biotech, Shanghai, China).

RT-PCR products of ci-Ins2 amplified with divergent primers were gel-purified using the PureLink Quick Gel Extraction Kit (Thermo Fisher Scientific). The purified PCR products were cloned into pGEM^®-T Easy Vector Systems (Promega) following the manufacturer’s protocol. Individual positive clones were selected for culture, and plasmids were purified using the plasmid isolation kit (HiMedia). The sequences of the cloned PCR products were confirmed by Sanger sequencing of the plasmids with T7 primer.

Specific primers for DNA and cDNA were used to amplify the regions of interest (Supplementary Table S10). Primers for APC and AXIN2 were described before^{21 (link),40 (link)}. Obtained PCR products were visualized using 1.5% Agarose gel with SYBR green. The PCR products were gel excised when necessary and purified using PureLink Quick Gel Extraction Kit (cat#K210012, Thermo Fisher Scientific, MA, USA). PCR products were sequenced using automated Sanger sequencing at Beckman Coulter Genomics, UK. The sequence chromatograms were analyzed using Codoncode Aligner 3.7.1 (CodonCode Corporation, MA, U.S) using NM_001904.3 as a reference sequence. Beta-actin was used as a reference gene for qPCR analysis. SsoAdvanced SYBR Green Supermix (Life Science, United States) was used to perform all the qPCRs on a CFX96 Real Time system (Bio-Rad Laboratories, CA, USA). The samples were run in triplicates and the ∆∆CT method was used to determine the relative expression levels. Log-transformed values were used for graphical representation.

Genomic DNA of iPSCs was extracted by PureLink Genomic DNA Mini Kit (Thermo Fisher Scientific) and amplified by PCR using PrimeSTAR GXL DNA Polymerase (TaKaRa Bio, Shiga, Japan) and Veriti thermal cycler (Thermo Fisher Scientific). The thermal conditions for PCR were 30 cycles of 10 s at 98°C, 15 s at 60°C and 1 min at 68°C. The amplified PCR products were extracted from agarose gel by PureLink Quick Gel Extraction Kit (Thermo Fisher Scientific). Sequencing analysis was done by 3500 xL Genetic analyser (Thermo Fisher Scientific). Forward (F) and reverse (R) PCR primers were as follows: F, 5′‐tgaccaggtgttgtgctagg‐3′, R, 5′‐ccgacttggggaggtttcg‐3′.

Sanger sequencing of available family members was carried out to confirm the familial co-segregation of retained variants. Primer sequences and amplification protocols are available on request. PCR products were purified using the PureLink Quick Gel Extraction Kit (Thermo Fisher Scientific) and then sequenced on an ABI 3100-4 automated sequencer (Applied Biosystems Inc, Foster City, CA, USA) according to the manufacturer’s instructions. Data of Sanger sequencing were analyzed using Bioedit software v7.1.3.