High-resolution melting real-time polymerase chain reaction (PCR) using Rotor-Gene Q instrument (QIAGENE) was performed using forward primer (5′ TGACAGACAAGAAGCGAGA 3′) and reverse primer (3′ ATGTGGGTATATTACAGGTG 5′) to amplify the DNA region containing the rs2229857 SNP (126bp) under the following condition: 95°C for 12 minutes followed by 40 cycles of 95°C for 1 second, 61°C for 20 seconds, and 72°C for 20 seconds. The temperature has been raised gradually from 65 to 95°C within 2 minutes. The software Rotor-Gene 6000 series version 1.7 was used to analyze the results. Chi-square test was employed for Hardy–Weinberg equilibrium and comparison of genotype and allele frequencies. Sanger sequencing was used to confirm the accuracy of the detected variant in at least 10%. Following primers designed via Primer 3 software (F: 5′- TGACAGACAAGAAGCGAGA -3′) and (R: 5′- ATGTGGGTATATTACAGGTG -3′) to amplify the region of interest, the PCR products (126bp) were subsequently visualized using 2% agarose gel and bidirectional sequencing was performed by on an ABI 3130 sequencer (Applied Biosystems). The sequences were compared with the ADAR1 gene reference sequence.
Rotor gene q instrument
Manufactured by Qiagen
Sourced in Germany, United States, Italy
The Rotor-Gene Q instrument is a real-time PCR cycler designed for accurate and reliable nucleic acid detection and quantification. It features a unique rotary design that enables efficient heat transfer and temperature control. The Rotor-Gene Q provides precise temperature regulation and high-resolution melt analysis capabilities.
Automatically generated - may contain errors
Lab products found in correlation
Rneasy mini kit, by Qiagen (11 mentions)
Trizol reagent, by Thermo Fisher Scientific (8 mentions)
Rotor gene sybr green pcr kit, by Qiagen (7 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (6 mentions)
Rotor gene probe pcr kit, by Qiagen (5 mentions)
Quantitect reverse transcription kit, by Qiagen (4 mentions)
Gotaq qpcr master mix, by Promega (4 mentions)
Qiaamp dna mini kit, by Qiagen (4 mentions)
Tri reagent, by Merck Group (4 mentions)
Qiaamp dna blood mini kit, by Qiagen (4 mentions)
Quantitect sybr green pcr kit, by Qiagen (4 mentions)
Miscript sybr green pcr kit, by Qiagen (4 mentions)
Rna extraction kit, by Accurate Biology (3 mentions)
Sybr premix ex taqtm, by Accurate Biology (3 mentions)
Sybr premix ex taq 2, by Takara Bio (3 mentions)
Oligo dt 23 primers, by New England Biolabs (3 mentions)
Rotor gene q system, by Qiagen (3 mentions)
Ambion dna free kit, by Thermo Fisher Scientific (3 mentions)
Superscript 3 reverse transcriptase, by Thermo Fisher Scientific (3 mentions)
Rneasy micro kit, by Qiagen (2 mentions)
137 protocols using rotor gene q instrument
1
High-resolution Melting PCR for ADAR1 SNP
2
Quantitative Analysis of mRNA Levels
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extraction of total RNA was performed with the RNeasy® Micro Kit (Qiagen, Hilden, Germany). A total of 1 μg total RNA was used for the reverse transcription reaction with the QuantiTect® reverse transcription kit for cDNA synthesis with integrated removal of genomic DNA contamination (Qiagen). qPCR reactions contained 5 µL of cDNA template in a 20 µL final volume with 1× PrimeTime® qPCR primers (Integrated DNA Technologies, Coralville, IA, USA) and 1× GoTaq® qPCR Master Mix (Promega). Real-time PCR of all samples including a minus reverse transcriptase control and no template control was performed in technical duplicates on the Rotor Gene Q instrument (Qiagene). mRNA levels were normalized for those of the housekeeping POLR2A transcript. Total RNA from a human thyroid (Cat. No. 636536) was from Clonthech.
3
Robust RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Example 10
Total RNA was extracted from cells and murine tissues using an RNeasy RNA extraction Mini-Kit (Qiagen). cDNA was synthesized using an Enzynomix kit (Enzynomix) and quantitative PCR was performed using gene-specific primer sets (Bioneer, Daejeon, Korea) and SYBR Green PCR Master Mix (Roche). Real-time PCR was performed using a Rotor-Gene Q instrument (Qiagen) according to the manufacturer's instructions. Data were normalized against gapdh expression. Relative expression was calculated using a delta-delta CT method. The sequences of the primers used are listed in Table 1.
4
Endpoint and Quantitative PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Endpoint PCRs were performed with MyTaqTM HS DNA Polymerase (Biocat, Heidelberg, Germany) and primers for RPL32 (hm RPL32 Ex02 for1 5′-GTGAAGCCCAAGATCGTCAA-3′ and hm RPL32 Ex03 rev1 5′-TTGTTGCACATCAGCAGCAC-3′) and mito p27 (hCDKN1B Ex01 for1 5′-GGTTAGCGGAGCAATGCG-3′ and myc-tag rev2 5′-TCCTCTTCTGAGATGAGTTTTTGTTC-3′) according to manufacturer’s recommen-dations in a Bio-Rad T100 Thermal Cycler (BioRad, Feldkirchen Germany). The reaction products were visualized on standard agarose gels.
Semi-quantitative real-time PCRs were used to determine the relative transcript levels of Trx-1 with corresponding primers (hm TXN1 Ex01 for1 5′-TGGTGAAGCAGATCGAGAGC-3′ and hm TXN1 Ex03/04 rev1 5′-ACATCCTGACAGTCATCCACAT-3′), cDNA as a template, and the primaQUANT 2x qPCR SYBR-Green-MasterMix (Steinbrenner, Wiesenbach, Germany) in a Rotor-Gene Q instrument (Qiagen, Hilden, Germany). Relative expression was calculated by the ΔCt method with RPL32 as a reference [19 (link)].
Semi-quantitative real-time PCRs were used to determine the relative transcript levels of Trx-1 with corresponding primers (hm TXN1 Ex01 for1 5′-TGGTGAAGCAGATCGAGAGC-3′ and hm TXN1 Ex03/04 rev1 5′-ACATCCTGACAGTCATCCACAT-3′), cDNA as a template, and the primaQUANT 2x qPCR SYBR-Green-MasterMix (Steinbrenner, Wiesenbach, Germany) in a Rotor-Gene Q instrument (Qiagen, Hilden, Germany). Relative expression was calculated by the ΔCt method with RPL32 as a reference [19 (link)].
5
BVDV Detection in Serum and Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleic acids were extracted from frozen serum or tissue samples in all cases using the QIAamp® cador® Pathogen Mini Kit (QIAGEN®, Germany), following the manufacturer’s instructions. Reverse transcription (RT) was performed using random primers and Super-Script II enzyme (Invitrogen®, USA). Real-time PCR assays targeting a 207-bp fragment of the 5′UTR region of the BVDV were performed using the primers BVDV190F and V326, and the Taq-Man® probe TQ-Pesti as described by Hoffman et al. [23 (link)] and Gaede et al. [24 (link)], respectively, and later modified by Maya et al. [18 (link)], to detect BVDV-1, BVDV-2, and the HoBi-like Pestivirus. All real-time PCRs were performed using the SensiMixTM II Probe Kit (Bioline Reagents Ltd.) and a Rotor-Gene Q instrument (Qiagen®) following the manufacturer’s recommendations.
6
Quantitative RT-PCR Analysis of Mouse Liver Lipid Metabolism
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from mouse livers was isolated using RNAiso Plus (Takara). Samples were prepared for RT-PCR using the PrimeScript ™ RT reagent Kit (Takara, RR036A) and SYBR Premix Ex TaqTM (Takara, RR820A), and RT-PCR was performed using a Rotor-Gene Q instrument (Qiagen). The relative expression of the target genes was calculated by the ΔΔCt method and each sample was done in triplicate. The sequences of primers were as follows:
| Gene name | Forward | Reverse |
| SREBP-1c | 5′-CAGACTCACTGCTGCTGACA-3′ | 5′-GATGGTCCCTCCACTCACCA-3′ |
| FAS | 5′-GGCCCCTCTGTTAATTGGCT-3′ | 5′-GGATCTCAGGGTTGGGGTTG-3′ |
| ACS | 5′-ATCAGGCTGCTTATGGACGA-3′ | 5′-ATCCCACAGGCTGTTGTTTC-3′ |
| SCD-1 | 5′-GTACCGCTGGCACATCAACT-3′ | 5′-AACTCAGAAGCCCAAAGCTCA-3′ |
| PPARα | 5′-TGCCTTCCCTGTGAACTGAC-3′ | 5′-TGGGGAGAGAGGACAGATGG-3′ |
| ACC | 5′-GCCTCAGGAGGATTTGCTGT-3′ | 5′-AGGATCTACCCAGGCCACAT-3′ |
| HAD | 5′-AAAACACCGATGACCAGCCA-3′ | 5′-TCTTCCTTAGACGCATCGCC-3′ |
| CPT-1 | 5′-GGACTCCGCTCGCTCATT-3’ | 5′-GAGATCGATGCCATCAGGGG-3′ |
| GAPDH | 5′-ATCACTGCCACCCAGAAGAC-3′ | 5′-AGATCCACGACGGACACATT-3′ |
7
Quantifying Gene Expression via RT-qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from cells using an RNA extraction kit (Accurate Biology, AG21017). Evo M-MLV RT Premix (Accurate Biology, AG11706) and SYBR Premix Ex TaqTM (Accurate Biology, AG11702) were used to prepare the samples for RT-qPCR, which was conducted on a Rotor-Gene Q instrument (QIAGEN, Germany). We calculated the relative expression levels of target genes based on the 2-ΔΔCT method. Table 2 lists the primer sequences.
8
Limit of Detection and Variability of pfs25 and pfMGET qRT-PCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To determine limit of detection (LOD) and intra-assay variability neat cRNA was serial-diluted in uninfected human blood extracts to produce 14 concentrations of pfs25 cRNA (1.59 × 106 to 0.05 copies/µL) and 11 concentrations of pfMGET cRNA (2.16 × 105 to 0.07 copies/µL), with emphasis on closer dilutions in the lower range to ensure enough data points for accurate estimation. Replicates (n = 5–8) of each dilution and a negative control (uninfected human blood extracts) were analysed on separate qRT-PCR runs on separate days (6 for pfs25 and 3 for pfMGET) on a Rotorgene Q instrument (Qiagen, Australia) with the same batch of mastermix used for each assay. The experiments and validation of the pfs25 assay occurred before repeating the process with the pfMGET assay. These data sets are hereafter referred to as data set A (pfs25) and data set B (pfMGET).
9
Stability Assessment of Solubilized Receptors
10
Thermal Stability Analysis of hCp149 and Variants
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!