Cells were scraped into NP-40 lysis buffer (50 mM Hepes, pH 7.5, 50 mM NaCl, 0.1 % NP-40) with fresh protease and phosphatase inhibitor cocktails according to the manufacturer’s instructions (Roche). Dephosphorylation was carried out by incubation with calf intestinal alkaline phosphatase (Invitrogen) exactly as described previously [37 (link)].
Calf intestinal alkaline phosphatase
Manufactured by Thermo Fisher Scientific
Sourced in United States, United Kingdom
Calf Intestinal Alkaline Phosphatase is a hydrolase enzyme that catalyzes the removal of phosphate groups from various molecules, including nucleotides, proteins, and alkaloids. It is derived from the intestinal mucosa of calves and is commonly used in molecular biology and biochemical applications.
Automatically generated - may contain errors
Lab products found in correlation
T4 dna ligase, by Thermo Fisher Scientific (4 mentions)
T4 dna ligase, by New England Biolabs (3 mentions)
Q5 high fidelity dna polymerase, by New England Biolabs (3 mentions)
Restriction endonuclease, by Thermo Fisher Scientific (2 mentions)
Mastercycler, by Eppendorf (2 mentions)
E coli top10 cells, by Thermo Fisher Scientific (2 mentions)
Smai restriction enzyme, by Thermo Fisher Scientific (2 mentions)
Pgex 6p 1 expression vector, by GE Healthcare (2 mentions)
Pgex 6p1 vector, by Thermo Fisher Scientific (2 mentions)
Smarter race cdna amplification kit, by Takara Bio (2 mentions)
T4 polynucleotide kinase, by Thermo Fisher Scientific (2 mentions)
Rneasy plant mini kit, by Qiagen (2 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Illustratm gfxtm pcr dna and gel band purification kit, by GE Healthcare (2 mentions)
Q5 high fidelity polymerase, by New England Biolabs (2 mentions)
Qiaprep spin miniprep kit, by Qiagen (2 mentions)
Restriction endonuclease, by New England Biolabs (2 mentions)
Wizard sv gel and pcr clean up system, by Promega (1 mentions)
Xhoi, by New England Biolabs (1 mentions)
Wizard dna clean up system, by Promega (1 mentions)
21 protocols using calf intestinal alkaline phosphatase
1
Protein Dephosphorylation from Cell Lysate
2
Plasmid DNA Preparation and Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA was prepared using the Monarch® Plasmid Miniprep Kit according to the manufacturer’s instructions (NEB). Enzymes for DNA manipulations included restriction endonucleases (NEB), T4 DNA ligase (NEB) and Calf Intestinal Alkaline Phosphatase (Invitrogen™, Thermo Fisher Scientific, Loughborough, UK). Gene cleaning was performed using the Monarch® PCR and DNA Cleanup Kit (NEB) following the manufacturer’s instructions. DNA polymerase used for PCR for cloning purposes was Q5® High-Fidelity DNA Polymerase (NEB), or Taq DNA polymerase (NEB) for verification of constructs. PCRs were performed in an Eppendorf® Mastercycler® (Stevenage, UK). Reaction mixtures were typically subjected to initial denaturation at 94 °C for 5 min followed by 35 cycles, denaturation at 94 °C for 30 s, annealing at the appropriate temperature for the primers for 30 s and extension at 72 °C for 30 s to 1 min depending on the length of amplicon, followed by a final extension cycle at 72 °C for 5 min. The amplified DNA was visualised by electrophoresis with 1% (w/v) agarose gels.
3
Cloning and Expression of α-L-Fucosidase Iso2
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The gene of α-l -fucosidase iso2 was inserted into the plasmid pET16b (Novagen) containing His-Tag. Plasmid was cleaved by restriction endonucleases NdeI and XhoI (New England BioLabs), dephosphorylated by Calf Intestinal Alkaline Phosphatase (Invitrogen) and purified by Wizard® DNA Clean-Up System (Promega Corporation). The DNA fragment containing the α-l -fucosidase gene was obtained by polymerase chain reaction (PCR) using primers, in which the NdeI restriction site was inserted at the 5’- end of the gene (GACGACGACATATG CGCTACAGACAGGTTCACC) and XhoI restriction site at the 3’- end (CCTTCCTCCTCGAG CTACTCATTATACTCTACGACG). The plasmid DNA from positive colony was used as a template. PCR product was purified by a commercial kit Wizard® SV Gel and PCR Clean-Up System (Promega Corporation). The purified DNA fragment was treated with NdeI and XhoI endonucleases, and ligated using T4-DNA ligase (New England BioLabs) to the linearized and dephosphorylated expression plasmid pET16b. The competent cells of E. coli DH5α were transformed [21 ] by the ligation mixture and cultivated on LB plates with ampicillin. Plasmid DNA of the arised colonies was screened by restriction endonucleases, and the gene of α-l -fucosidase iso2 in the positive colony was confirmed by sequencing. The name pET16b-αLF2 is used for this construct in the text.
4
Construction of PARE, C-PARE, and SPARE Libraries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PARE libraries were constructed as previously described (39 (link),53 (link)) modified for the Illumina HiSeq platform (54 (link)). C-PARE libraries were similarly constructed except poly(A)+ mRNA was dephosphorylated with calf intestinal alkaline phosphatase (Invitrogen) then decapped using tobacco acid pyrophosphatase (Epicentre) prior to library construction. SPARE libraries were constructed as previously described (55 (link)) with modifications described in Supplementary Methods. RNA-Seq libraries were constructed from poly(A)+ RNA using the TruSeq RNA sample prep kit (Illumina).
5
DNA Adapter Dephosphorylation Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 10-μl reaction consisted of 0.68 μl water, 8 μl of 5 × HF buffer (Thermo Scientific), 0.32 μl of 25 mM dNTP (Promega) and 1 μl of 2 U μl−1 phusion high-fidelity DNA polymerase (Thermo Scientific), which was added to the ligation reaction. The reaction was incubated at 72 °C for 45 min (optional stop point: you may freeze the samples at −20 °C at this point and continue the procedures the next day). Dephosphorylation was performed to remove the phosphate groups of excess PE 2 adaptors in the reaction by the addition of 20 U calf-intestinal alkaline phosphatase (Invitrogen). The reaction was carried out at 37 °C for 1 h. 20 U was exactly what we used, 20 U of calf-intestinal alkaline phosphatase were added to the reaction and incubated at 50 °C for 1 h to maximize the phosphatase activity at the 5′ recessed end of the adaptors. The reactions were then purified with MinElute reaction cleanup kit (Qiagen) and eluted in 10 μl EB buffer.
6
Enzymatic Assay for 5mC Detection
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The enzymatic assays were performed according to the previous report (34 (link)). Briefly, 1 μM CcTet-ΔN16 enzymes were mixed with 1 μM of 19-bp single 5mC-containing dsDNA (DNA sequences: 5′-TCTGGAA(5mC)GGAATTCTTCA-3′; 5′-TGAAGAATTCCGTTCCAGA-3′) in the buffer containing 50 mM HEPES, pH 7.0, 100 mM NaCl, 400 μM α-ketoglutarate and 200 μM Fe(NH4)2(SO4)2. The reactions were incubated for 30 min at 37°C in triplicates. The reactions were quenched by heating to 95°C for 5 min and immediately cooled in an ice bath. Subsequently, the products were digested with Nuclease P1 (catalog no. M0660S; New England Biolabs) and Calf Intestinal Alkaline Phosphatase (catalog no. 18009019; Invitrogen) at 37°C. The final solution was monitored by quantitative mass spectrometry (LC–MS/MS).
7
Enzymatic Phosphate Analysis Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Polyphosphates, reagents and solvents were purchased from Sigma-Aldrich, BioChemika, VWR, Oakwood, Thermo Fisher, Ambeed or TCI and used without further purification unless stated otherwise. Calf intestinal alkaline phosphatase was purchased from Invitrogen, catalogue number: 18009019. Phytase from wheat was purchased from Sigma-Aldrich, catalogue number: P1259. The reagent solutions were freshly prepared daily. The pH and pD values were verified on a Mettler Toledo Benchtop F20 pH mV−1 Standard Kit pH meter calibrated with three standard buffer solutions. The pH readings were converted to pD by adding 0.4 units.
8
Plasmid Preparation and DNA Manipulation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Plasmid DNA was prepared using the Monarch® Plasmid Miniprep Kit according to the manufacturer’s instructions (NEB). Enzymes for DNA manipulations included restriction endonucleases (NEB), T4 DNA ligase (NEB) and Calf Intestinal Alkaline Phosphatase (Invitrogen™, Thermo Fisher Scientific, Loughborough, UK). Gene cleaning was performed using the Monarch® PCR & DNA Cleanup Kit (NEB) following the manufacturer’s instructions. DNA polymerase used for PCRs was Q5® High-Fidelity DNA Polymerase (NEB) for cloning purposes or Taq DNA polymerase (NEB) for verification of constructs or for colony PCR. PCRs were performed in an Eppendorf® Mastercycler® (Stevenage, UK)). Reaction mixtures were typically subjected to initial denaturation at 94 °C for 5 min followed by 35 cycles: Denaturation at 94 °C for 30 s, annealing at the appropriate temperature for the primers for 30 s and extension at 72 °C for 30 s to 1 min depending on the length of amplicon, and a final extension cycle at 72 °C for 5 min. The amplified DNA was visualised by electrophoresis with 1% w/v agarose gels.
9
Linearization and Dephosphorylation of Plasmids
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Five micrograms of pAUrumII was digested 15 h at 37°C using 6 U/μg of the type IIS RE LguI (SapI) (Fermentas) in a 100 μL reaction solution. In another 100 μL reaction solution containing 20 μM S-adenosyl methionine, 5 μg pAUrumIII was digested 15 h at 25°C using 10 U/μg of the type IIB RE BaeI (New England Biolabs). Both digestions were terminated at 65°C for 20 min, and to further reduce the risk of transforming with empty vectors, both the linearized vectors, pAUrumIILIN or pAUrumIIILIN, were treated with 0.6 U/μg calf intestinal alkaline phosphatase (Invitrogen) for 30 min at 37°C before purification.
10
Cloning H-Ras Gene into pTRE-Tight Vector
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!