Overnight cultures were grown in tryptic soy broth at 37°C with 200-rpm shaking. Genomic DNA was extracted from cultures by using the automated Maxwell DNA instrument using the Maxwell® RSC Cultured Cells DNA Kit (Promega, United Kingdom). Library preparation was carried out using the Nextera XT kit and paired end 2 × 250 bp sequencing on the MiSeq, all following standard Illumina protocols (Illumina, Inc., United States). All raw reads have been deposited in the Sequence Read Archive database in the European Nucleotide Archive under the study accession number PRJEB26533.
Maxwell rsc cultured cells dna kit
Manufactured by Promega
Sourced in United States, United Kingdom
The Maxwell® RSC Cultured Cells DNA Kit is a product designed for the automated purification of genomic DNA from cultured cells. It utilizes magnetic bead-based technology to efficiently extract and isolate DNA samples from various cell types.
Automatically generated - may contain errors
Lab products found in correlation
Maxwell rsc instrument, by Promega (6 mentions)
Nanodrop, by Thermo Fisher Scientific (3 mentions)
Nextera xt dna library preparation kit, by Illumina (3 mentions)
Maxwell rsc simplyrna cells kit, by Promega (3 mentions)
Nextera xt kit, by Illumina (2 mentions)
Maxwell rsc 48 instrument, by Promega (2 mentions)
Nextseq 550 system, by Illumina (2 mentions)
Hiseq platform, by Illumina (2 mentions)
Nanodrop one, by Thermo Fisher Scientific (2 mentions)
Infinium hd assay ultra, by Illumina (2 mentions)
Iscan system, by Illumina (2 mentions)
Humancytosnp 12 assay, by Illumina (2 mentions)
Qubit 4 fluorometer, by Thermo Fisher Scientific (2 mentions)
Dna prep m tagmentation kit, by Illumina (1 mentions)
Qubit fluorometer, by Thermo Fisher Scientific (1 mentions)
Ez dna methylation kit, by Zymo Research (1 mentions)
Pmd19 t vector, by Takara Bio (1 mentions)
Infinium omni2.5 8 v 1 3 beadchip, by Illumina (1 mentions)
Nextseq sequencer, by Illumina (1 mentions)
Kapa hyperplus, by Roche (1 mentions)
34 protocols using maxwell rsc cultured cells dna kit
1
Automated Genomic DNA Extraction and Sequencing
2
Whole-Genome Sequencing of Salmonella
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using the Maxwell RSC cultured cells DNA kit with a Maxwell RSC instrument (Promega Corporation, Madison, WI, USA) following the manufacturer’s protocols for Gram-negative bacteria with additional RNase treatment. DNA concentrations were measured with a Qubit fluorometer (Life Technologies, Carlsbad, CA, USA), standardized to 0.2 ng/µL, and the samples were stored at 4 °C before library preparation.
Whole-genome sequencing (WGS) of the Salmonella isolates was performed by the Public Health Agency of Canada (PHAC) Laboratory and Food and Drug Administration (FDA): Center for Food Safety and Applied Nutrition genomics laboratory (FDA-CFSAN) and Center for Veterinary Medicine (FDA-CVM), Maryland, USA. The WGS data was generated on an Illumina MiSeq using 2× 250 bp and 2 × 300 bp paired-end chemistry (Illumina Inc., San Diego, CA, USA) according to the manufacturer’s instructions, at 50–150X coverage. According to the manufacturer’s instructions, the libraries were constructed using 100 ng of genomic DNA using the Illumina DNA Prep (M) Tagmentation kit (Illumina Inc., San Diego, CA, USA) and the Nextera XT kit (Illumina Inc., San Diego, CA, USA).
Whole-genome sequencing (WGS) of the Salmonella isolates was performed by the Public Health Agency of Canada (PHAC) Laboratory and Food and Drug Administration (FDA): Center for Food Safety and Applied Nutrition genomics laboratory (FDA-CFSAN) and Center for Veterinary Medicine (FDA-CVM), Maryland, USA. The WGS data was generated on an Illumina MiSeq using 2× 250 bp and 2 × 300 bp paired-end chemistry (Illumina Inc., San Diego, CA, USA) according to the manufacturer’s instructions, at 50–150X coverage. According to the manufacturer’s instructions, the libraries were constructed using 100 ng of genomic DNA using the Illumina DNA Prep (M) Tagmentation kit (Illumina Inc., San Diego, CA, USA) and the Nextera XT kit (Illumina Inc., San Diego, CA, USA).
3
Methylation Analysis of ColXV Gene
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The methylation of ColXV was analyzed by bisulfite sequencing. Adipocyte and adipose tissue genomic DNA was extracted with Maxwell® RSC Cultured Cells DNA Kit (Promega, USA). Three DNA pools from each group were performed by sodium bisulfite treatment using the EZ DNA Methylation Kit (Zymo Research, USA). The primers were designed by online Methprimer software (http://www.urogene.org/cgi-bin/methprimer/methprimer.cgi ). The primers in ColXV promoter for bisulfite sequencing PCR (BSP) were as follows: forward TTTATTGGATGGATGTTTTGGTAA, reverse CCACTTACATACCCCAAAATAACAC. While the primers in ColXV intron 1 were as follows: forward GAGGTGGTTGTTTTTTATTATTTT, reverse AACCCAAACACTCTTATATACCTTC. Modified genomic DNA was served as the template for PCR amplification immediately and PCR products were gel purified using Gel Purification Kit (Omega, USA). Then purified DNA were cloned into the pMD19-T vector (Takara, China) and then transformed into Escherichia coli. Later, competent cells were plated on lysogeny broth (LB) solid medium and identified by blue-white selection. Positive clones for each subject were randomly selected for sequencing (Invitrogen, China).
4
Karyotype Analysis for Cell Line Validation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
G-banded karyotype analysis was performed on 5 × 106 cells collected at passage five (for HiFi, Nanopore and Omni-C) and passage eight (for ONT-UL). For all cell lines, 20 metaphase cells were counted, and a minimum of 5 metaphase cells were analysed and karyotyped. Chromosome analysis was performed at a resolution of 400 bands or greater. A pass/fail criterion was used before cell lines proceeded to sequencing. Cell lines with normal karyotypes (46,XX or 46,XY) or lines with benign polymorphisms that are frequently seen in apparently healthy individuals were classified as passes. Cell lines were classified as failures if two or more cells harboured the same chromosomal abnormality. DNA used for microarray was isolated from frozen cell pellets (3 × 106 to 7 × 106 cells) using a Maxwell RSC Cultured Cells DNA kit on a Maxwell RSC 48 instrument (Promega). DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using an Infinium Omni2.5-8 v.1.3 BeadChip (Illumina) on an iScan System instrument (Illumina).
5
Isolation and Characterization of SEQ-9 Resistant Mycobacterium tuberculosis Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
109 or 108 CFU from an exponential Mtb H37Rv culture in Middlebrook 7H9 broth medium supplemented with 10% (v/v) oleic acid-albumin-dextrose-catalase (OADC), 0.4% (v/v) glycerol and 0.05% (v/v) Tween 80 were spread on 7H11 agar plates containing SEQ-9 at 4, 8 or 16 X MIC (7H11 agar powder, 0.5% glycerol,10% OADC) and allowed to growth at 37 °C and 5 % CO2 in plastic bags for 5 weeks. Among the SEQ-9 concentrations and the Mtb suspensions plates, 10 colonies were chosen and dispersed in 25 ml of 7H9 broth medium in 125 ml Erlenmeyer flask and incubated for 7 to 13 days with shaking until DO600 ∼0.8. Cultures were then centrifuged, and cells were frozen at -80°C in 15% Glycerol for long conservation (primary stock). PBS stocks were prepared from this primary stock to evaluate the resistance profile to various molecules in the MABA test previously described. Stability of the mutation was assessed in the MABA test on cultures obtained after 3 consecutive passages without SEQ-9. DNA from each mutant was extracted using MaxWell RSC Instrument with the Maxwell RSC Cultured Cells DNA Kit (Promega) according to the manufacturer’s instruction. DNA concentration was measured with nanodrop (Thermo Scientific) and sequenced.
6
Whole-Genome Sequencing of Enterococcus Species
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The strains belonging to E. faecalis (n = 50) and E. faecium (n = 10) were subjected to whole-genome sequencing. DNA extraction was prepared from nutrient agar plate cultures with a Maxwell® RSC Cultured Cells DNA Kit—Automated DNA Purification from Mammalian and Bacterial Cultured Cells (AS1620 Promega, Madison, WI, USA), according to the manufacturer’s instructions, with a Maxwell® RSC Instrument (Promega, Madison, WI, USA). Sequencing libraries were prepared with KAPA HyperPlus (Roche, Pleasanton, CA, USA) according to the manufacturer’s protocol. Whole-genome sequencing was performed on the NextSeq sequencer (v2.5 2 × 150 bp, Illumina, San Diego, CA, USA).
7
Whole-Genome Sequencing of Cultured Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using a Maxwell RSC Cultured Cells DNA Kit (Promega) and its quality determined in an Agilent 5200 Fragment Analyzer System using a Genomic DNA 50 kb Kit (Agilent). Indexed pair-end libraries were prepared with TruSeq DNA Library Prep Kit (Illumina Inc, USA) and sequenced with NextSeq 550 System Mid-Output Kit (Illumina Inc, USA) in a NextSeq 500 System Whole-Genome Sequencing Solution (Illumina Inc, USA). The resulting paired-end reads were 150 bp long.
8
DNA Extraction and Sequencing Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted using the Maxwell® RSC Cultured Cells DNA Kit (Promega, Madison, Wisconsin, USA) using the manufacturer’s instructions. Libraries were created using the Nextera XT DNA Library Preparation Kit (Illumina, San Diego, California, USA) and sequenced on a NextSeq 550 System (Illumina) as 2 × 150 bp paired-end reads.
9
DNA Extraction from Nutrient Agar Cultures
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was extracted from nutrient agar plate cultures with a Maxwell RSC Cultured Cells DNA Kit (Promega, Madison, WI, USA), according to the manufacturer’s protocol. The quantity and quality of the DNA was determined using the NanoDrop 1000 system (Thermo Scientific). The tris-ethylenediaminetetraacetic acid used for sample preparation was the negative control. Samples were frozen at -20°C.
10
Genomic DNA Extraction and MLST Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from animal and human isolates was purified using the kit Maxwell® RSC Cultured Cells DNA Kit (Promega). Libraries were prepared by using Nextera XT DNA Library Preparation Kit and sequenced on a MiSeq platform by using version 3 reagents for 2 × 300 paired-end libraries (both from Illumina, https://www.illumina.com ). Raw reads were uploaded on the EnteroBase online platform for Salmonella and genomes are available under the following Uberstrains names: SAL_OB9295AA to SAL_OB9715AA. Using the Salmonella scheme from EnteroBase, we performed an in silico MLST analysis based on seven housekeeping gene loci (aroC, dnaN, hemD, hisD, purE, sucA and thrA) to identify the sequence type.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!