Mastercycler ep realplex pcr system

Thymic tissue was lysed for RNA extraction by the RNeasy Plus Mini Kit (Qiagen, Valencia, California) in accordance with manufacturer instructions. The total RNA concentration was measured by spectrophotometry in a Nanodrop ND1000 system, and the first‐strand cDNA was synthesized from total RNA using the High‐Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Foster City, California). Relative mRNA levels were measured with Bryt Green (Promega, Fitchburg, Wisconsin) using a Mastercycler ep realplex PCR system (Eppendorf, Hamburg, Germany). All experiments were performed in triplicate. The relative level of each gene was normalized to the housekeeping gene acidic ribosomal phosphoprotein P0 (36B4) and expressed as the fold change relative to the CTRL group using the 2^−ΔΔCt method, where ΔCt = Ct_{(target gene)} − Ct_{(housekeeping gene).}16 The mRNA expression of the following genes was analyzed: indoleamine 2,3‐dioxygenase (IDO)‐2, CD39, galectin, cytotoxic T‐lymphocyte‐associated antigen (CTLA)‐4, PD‐1, and IL‐10. The sequences of PCR primers can be found in Supporting Information Table S1.

Total bacterial RNA was extracted using TRIzol^® (Life Technologies^™, USA), and cDNA was produced using reverse transcriptase and random hexamers as described previously [42 (link)]. qRT-PCR was conducted with the Mastercycler^® ep realplex PCR system (Eppendorf South Pacific, Australia) using FastStart Universal SYBR Green Master (Rox) as the master mix (Roche Diagnostics, Australia). The primer pairs JT7472/JT7473 and JT7474/JT7475 (S2 Table) were designed for the amplification of bopE and the internal control rpoA (BPSL3187), respectively, using the Primer3 primer design software (http://simgene.com/Primer3). These primer pairs amplified PCR products of 119 and 90 bp, respectively. Each qRT-PCR mixture was prepared by addition of 5 μl of 1:10 dilution of cDNA to 15 μl of PCR master mix containing 10 μl of FastStart Universal SYBR Green Master (Rox), 0.2 μl of each primer (100 μM) and 4.6 μl of DEPC-treated nuclease-free water (Ambion). The genomic DNA of B. pseudomallei wild-type strain K96243 and RT-negative samples were used as positive and negative controls, respectively. The cycling parameters for amplification were as follows: 1 cycle of 95°C for 2 min, 40 cycles of 95°C for 15 sec and 60°C for 1 min. All qRT-PCR experiments were carried out in technical triplicate on biological duplicates.

Mitochondrial DNA (mtDNA) damage in HUVECs was analysed by quantitative PCR as previously described.23 Briefly, DNA was extracted using a QIAamp DNA Micro kit (Qiagen, West Sussex, UK) and real‐time PCR reactions were performed on the Mastercycler EP realplex PCR System (Eppendorf, Wesseling‐Berzdorf, Germany) according to manufacturer's protocol. The primers for mtDNA and β‐globin were as follows: mtDNA (sense: 5′‐CCC CAC AAA CCC CAT TAC TAA ACC CA‐3′; antisense: 5′‐TTT CAT CAT GCG GAG ATG TTG GAT GG‐3′); β‐globin (sense: 5′‐CGA GTA AGA GAC CAT TGT GGC AG‐3′; antisense: 5′‐GCT GTT CTG TCA ATA AAT TTC CTTC‐3′). Gene expression was calculated by using the comparative cycle threshold (ΔΔ Ct) method and relative expression of mtDNA was normalized with β‐globin.

Total RNA was extracted from the hippocampus with the PureLink^TM RNA Mini Kit (Thermo Fisher Scientific). RNA quantity and quality was determined using a NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific). Complementary DNA was synthesized from 1 μg of total RNA with SuperScript^TM III Reverse Transcriptase (Invitrogen). qPCR-based quantification of Kcnmb2 was performed using a MasterCycler ep realplex PCR system (Eppendorf) and QuantiFast SYBR Green PCR Kit (Qiagen). The PCR cycling parameters were as follows: 95°C for 5 min, followed by 40 cycles of PCR reaction at 95°C for 5 s, 60°C for 30 s, 72°C for 30 s. Actb was used as housekeeping control for all samples. The expression of Kcnmb2 in the MD F1 group was normalized to that observed in the CD F1 control group. The following PCR primer sequences were used: Kcnmb2-F TGCAGGACCAACATCCTCTAAG, Kcnmb2-R CTTCAGAGCTGTCACAGTTTTCC; Actb-F CACTCTTCCAGCCTTCCTTC, Actb-R GTACAGGTCTTTGCGGATGT.

To detect the genomic RNA released from the ZIKV particles, the RNase digestion assay and RT-qPCR were developed as previously described [27 (link),35 (link)]. Briefly, Ery-Est and Ery were incubated with ZIKV (1 × 10³ PFU) at 37 °C for 2 h. Then, the released RNA from treated ZIKV was digested by micrococcal nuclease (New England BioLabs, Ipswich, MA, USA) for 1 h at 37 °C, followed by the inactivation of the residual RNase. Then, the undigested genomic RNA inside the unbroken virus was extracted using the EasyPure Viral DNA/RNA Kit (Transgen Biotech, Beijing, China) and detected using TransScript II Green One-Step qRT-PCR SuperMix (Transgen Biotech, Beijing, China) and the Master Cycler Ep Realplex PCR system (Eppendorf, Hamburg, Germany) in accordance with the manufactures’ instructions. The primers used to detect the RNA sequences coding viral E protein were as follows: F1 (5′-TGGAGGCTGAGATGGATGG-3′)/R1 (5′-GAACGCTGCGGTACACAAGGA-3′).

To test whether Ery-Est could induce genomic RNA release of HCoV-OC43, RNase digestion assay and RT-qPCR were performed as previously described (Wang et al., 2019 (link)). Serial concentrations of Ery-Est and Ery were incubated with HCoV-OC43 for 2 h, and micrococcal nuclease (New England BioLabs, Ipswich, MA, USA) was then added to the mixture and incubated for 2 h at 37°C to digest the released RNA from treated viruses. After the inactivation of RNase, the EasyPure Viral DNA/RNA Kit (Transgen Biotech, Beijing, China) was used to extract genomic RNA of integral viruses, which was then detected with TransScript II Green One-Step qRT-PCR SuperMix (Transgen Biotech, Beijing, China) by a Master Cycler Ep Realplex PCR system (Eppendorf, Hamburg, Germany) according to the manufacturer’s instructions. Primers used in RT-qPCR to detect HCoV-OC43 RNA sequence coding viral nucleoprotein were as follows: F1 (5′-AGCAACCAGGCTGATGTCAATACC-3′)/R1 (5′-AGCAGACCTTCCTGAGCCTTCAAT-3′).