Rat OPCs were transfected with biotin-tagged miR-219 mimics or control cel-miR-67 (Dharmacon) at a final concentration of 40 nM using Lipofectamine 2000 (Life Tech). Forty-eight hours later, the cells were lysed in lysis buffer [20 mM Tris pH 7.5, 200 mM NaCl, 2.5 mM MgCl2, 0.05% Igepal, 60 U Superase-In/ml (Ambion, AM2694), 1 mM DTT, 1 × Pefabloc (Sigma)]. The streptavidin-agarose beads (GE Healthcare, 17-5113-01) were incubated with cell lysate at 4 °C for 1 hour followed by washing with lysis buffer. Total mRNAs bound to the streptavidin beads were extracted by using TRIzol LS (Invitrogen). The pull-down mRNA level was quantified by mRNA-seq. The total mRNA from OPC transfected with biotin-tagged miR-219 mimics or control cel-miR-67 (Dharmacon) as input was quantified by mRNA-seq. The enrichment ratio was calculated, [miR-219/Ctrl (Pulldown)]/[miR-219/Ctrl (Input)] (Lal et al., 2011 (link)).
Cel mir 67
Manufactured by Horizon Discovery
Sourced in United States
Cel-miR-67 is a synthetic microRNA (miRNA) derived from the model organism Caenorhabditis elegans. It serves as a suitable control for miRNA detection and quantification experiments.
Automatically generated - may contain errors
Lab products found in correlation
Miridian mirna hairpin inhibitors directed against mmu mir 135b 5p, by Horizon Discovery (2 mentions)
Pre mir 135b 5p, by System Biosciences (2 mentions)
Cd513, by System Biosciences (2 mentions)
Luciferase assay kit, by Promega (2 mentions)
Dharmofect 1, by Horizon Discovery (2 mentions)
Lipofectamine 2000, by Thermo Fisher Scientific (2 mentions)
Jetpei transfection reagent, by Polyplus Transfection (1 mentions)
N ter nanoparticle sirna transfection system, by Merck Group (1 mentions)
Superase in, by Thermo Fisher Scientific (1 mentions)
Streptavidin agarose beads, by GE Healthcare (1 mentions)
Streptavidin beads, by Thermo Fisher Scientific (1 mentions)
Trizol ls, by Thermo Fisher Scientific (1 mentions)
Pefabloc, by Merck Group (1 mentions)
Psicheck 2, by Horizon Discovery (1 mentions)
Quikchange 2 xl site directed mutagenesis kit, by Agilent Technologies (1 mentions)
Psicheck 2 vector, by Promega (1 mentions)
Dual luciferase reporter assay system, by Promega (1 mentions)
Pmir reporter vector, by Thermo Fisher Scientific (1 mentions)
Lincode non targeting pool, by Horizon Discovery (1 mentions)
Opti mem, by Thermo Fisher Scientific (1 mentions)
11 protocols using cel mir 67
1
Biotin-tagged miR-219 Transfection and Pulldown
2
Modulating miR-598-3p in Fear Behavior
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Hairpin inhibitors directed against mmu-miR-598-3p or the nonmammalian miRNA cel-miR-67 were obtained from GE Dharmacon (Lafayette, CO) and injected bilaterally into the BLA (AP: 1.5 mm, ML: ±3.2 mm from bregma and DV: −4.7 mm from the skull) as previously described (Young et al. 2016 (link)). The injection needle was left in place for 5 min after the infusion was complete. Inhibitors were reconstituted in water then prepared with jetPEI transfection reagent (Polyplus Transfection). One micro liter per hemisphere of 400 ng/µL was injected 28 d after FC, animals remained in the home cage for 2 d, and then were tested for either remote fear memory expression, anxiety-like behavior, and/or sacrificed such that mir-598-3p levels could be measured via qPCR.
3
Transfection of Axons with miRNA Inhibitors
4
Lentiviral Overexpression of miR-135b-5p
5
MiR-19 Regulation of SOCS-3 Expression
6
Lentiviral Overexpression of miR-135b-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Miridian miRNA hairpin inhibitors directed against mmu-miR-135b-5p or the nonmammalian miRNA cel-miR-67 were obtained from GE Dharmacon (Lafayette, CO). To overexpress (OE) mir-135b-5p, pre-miR-135b-5p or a scramble nontargeting control sequence in the lentiviral vector CD513 were obtained from System Biosciences (Palo Alto, CA). The OE vector was packaged with GFP into lentivirus using a 2nd generation packaging system at the Emory Viral Vector Core (Emory University, Atlanta, GA). Titers obtained were 3×108 iu/ml for OE.
7
MiR-19 Regulation of SOCS-3 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
293T cells (ATCC) were transfected with the 3'UTR SOCS-3 luciferase/RFP construct (Origene; SC215826), miR-19 mimics and scrambled controls (based on cel-miR-67, mature sequence: UCACAACCUCCUAGAAAGAGUAGA; Dharmacon), using DharmoFECT 1. Cells were analyzed 48hrs later, using the Luciferase Assay kit (Promega). Transfection efficiency was normalized to RFP signals.
8
Cloning and Validating 3'UTR Constructs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The 3'UTR regions of human CLSTN1 (NM_001009566.2, 1-1,426), DLGAP4 (XM_005260333.3, 1-1,602), GRASP ( X M _ 0 1 1 5 3 7 9 9 6 . 1 , 1 - 6 3 6 ) , GRIN1 ( N M _ 0 0 7 3 2 7 . 3 , 1-1,235), GRM4 (XM_011514531.1, 1-947), and STX1A (XM_011516541.1, 1-1,157) were PCR amplified from fetal or adult brain cDNA libraries and subcloned into the psiCHECK-2 vector (Promega). Mutagenesis reactions of the GRM4 3'UTR construct were performed using the QuikChange XL II Site-Directed Mutagenesis Kit (Agilent Technologies) to change the three nucleotides of the miR-1908-5p seed match regions (position 4 to 6, CGC) into complementary sequences (GCG). HEK293T cells in 24-well plates were transfected with 30 ng of psiCHECK-2 construct plus 20 pmol of either cel-miR-67 (negative control miRNA) or miR-1908-5p duplex (miRIDIAN Dharmacon) using Lipofectamine 2000 (Invitrogen). After 24 h, luciferase activities were measured using the Dual Luciferase Reporter Assay System (Promega).
9
miRNA and siRNA Dual Reporter Assay
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All the reporters were generated by inserting synthetic oligonucleotide DNA linkers of MRE sequences or their mutants into the pMIR-REPORTER vector (Applied Biosystems) downstream of luciferase gene through Hind III and Spe I sites. Native RNA duplexes for miR-146b and siEGFP (siRNA against EGFP) were custom-synthesized by Integrated DNA Technology. miRIDIAN miR-146b mimic and a negative control (cel-miR-67, which has no sequence identity with miRNAs in human, mouse and rat) were purchased from Dharmacon. Locked nucleic acid (LNA) anti-sense oligonucleotides were purchased from Exiqon, Inc.
10
Chemical Synthesis of siRNA-6Ø and miRNA Duplexes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Custom synthesis and modification services of ST Pharm (Korea) and Bioneer (Korea) were used to chemically synthesize siRNAs. dSpacer (abasic deoxynucleotide) was introduced to position 6 for producing siRNA-6Ø. siRNA duplexes were produced in vitro by following the reaction (90°C for 2 min, 30°C for 1 h and 4°C for 5 min). The miRNAs (mmu-miR-124-3p) that we used here were synthesized and duplexed with the same sequences in miRBase (http://www.mirbase.org/ ). A non-targeting siRNA (NT), derived from cel-miR-67 (Caenorhabditis elegans–specific miRNA provided as a negative control by Dharmacon), contains 6Ø in both guide and passenger strands and used as control.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!