Single CTCs were picked by micromanipulation (micro injector CellTram Vario and micromanipulator TransferManNKII, Eppendorf Instruments, Hamburg, Germany). The genomes of the picked cells were amplified by whole genome amplification (WGA) using the Ampli1TM WGA Kit for single cells (Menarini Silicon Biosystems, Florence, Italy) and the quality of the WGA product was assessed by multiplex PCR of the GAPDH gene producing 96, 108–166, 299 and 614 bp fragments using the Ampli1™ QC Kit (Menarini Silicon Biosystems) as described before [13 (link)]. The PCR products were analyzed using a 2% agarose TAE gel, and samples producing three or four bands were chosen for the NGS analyses. As a positive control, human leukocyte DNA was used.
Ampli1 qc kit
Manufactured by Menarini Silicon Biosystems
Sourced in Italy, United States
The Ampli1™ QC Kit is a laboratory equipment product designed for quality control purposes. It is used to assess the quality and integrity of genomic DNA samples prior to further downstream processing or analysis. The kit provides a standardized workflow to evaluate DNA sample quality parameters.
Automatically generated - may contain errors
Lab products found in correlation
Ampli1 wga kit, by Menarini Silicon Biosystems (5 mentions)
Nanodrop 2000, by Thermo Fisher Scientific (2 mentions)
Qubit 2.0 fluorometer, by Thermo Fisher Scientific (2 mentions)
Celltracker orange, by Thermo Fisher Scientific (1 mentions)
Eclipse ti2 microscope, by Nikon (1 mentions)
Novaseq platform, by Illumina (1 mentions)
Oncoquick, by Greiner (1 mentions)
Chemidoc, by Bio-Rad (1 mentions)
Allprep dna rna protein kit, by Qiagen (1 mentions)
Repli g ffpe kit, by Qiagen (1 mentions)
Generead dna ffpe kit, by Qiagen (1 mentions)
Repli g single cell kit, by Qiagen (1 mentions)
Qiaamp dna blood mini kit, by Qiagen (1 mentions)
Deparray system, by Menarini Silicon Biosystems (1 mentions)
Cellsearch epithelial cell kit, by Menarini Silicon Biosystems (1 mentions)
Cellsearch system, by Menarini Silicon Biosystems (1 mentions)
Chemidoc instrument, by Bio-Rad (1 mentions)
Giemsa, by Merck Group (1 mentions)
Deparray nxt system, by Menarini Silicon Biosystems (1 mentions)
Deparray cartridge, by Menarini Silicon Biosystems (1 mentions)
11 protocols using ampli1 qc kit
1
Single-Cell Genome Amplification and Validation
2
Single-cell genomic analysis of circulating tumor cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The CellSearch-enriched CMCs were picked up by laser capture microdissection with the MMI CellCut system (Molecular Machines & Industries GmbH, Eching, Germany) mounted on an ECLIPSE Ti2 microscope (Nikon Corporation, Tokyo, Japan), subjected to Ampli1 WGA (Menarini Silicon Biosystems) according to the manufacturer’s instructions (with minor modifications), and finally sent to Menarini Silicon Biosystems for NGS analysis with the Ampli1 OncoSeek Panel, which is designed specifically to fit with the Ampli1 WGA protocol (Supplementary Material—Materials and Methods). To validate the entire workflow, 44 samples from different tumor cell lines in the form of spike-in samples or cells suspended in their medium were enriched by the CellSearch platform or simply stained in culture (CellTracker Orange, Thermo Fisher Scientific) to undergo microdissection at the single-cell or cluster level, and finally WGA. Additional samples were also subjected to Ampli1 OncoSeek analysis to validate the entire workflow.
When analyzing patient samples, a minimum of 5 cells per CellSearch cartridge were microdissected to increase the chance of a successful WGA reaction. White blood cells were collected together if the number of CMCs was <5. The quality of the WGA products was tested using the Ampli1 QC Kit (Menarini Silicon Biosystems) following the manufacturer’s instructions.
When analyzing patient samples, a minimum of 5 cells per CellSearch cartridge were microdissected to increase the chance of a successful WGA reaction. White blood cells were collected together if the number of CMCs was <5. The quality of the WGA products was tested using the Ampli1 QC Kit (Menarini Silicon Biosystems) following the manufacturer’s instructions.
3
Single-Cell Whole Genome Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The genetic material of the isolated single cells (representative for each cell population in every patient) was amplified using the adapter–linker PCR, based on MseI digestion as described [21 (link),22 (link)] which is now commercially available as the Ampli1TM whole genome amplification (WGA) kit by Menarini Silicon Biosystems. The genomic integrity index (GII) was used to assess the quality of the WGA [23 (link)] (Ampli1™ QC Kit, Menarini Silicon Biosystems). WGA was performed with 111 samples, and 77 (69.4%) presented quality compatible with further downstream analysis of copy number variation (CNV) using the low pass next-generation sequencing [24 (link)]. Ampli1™ low pass library preparation was performed by Menarini Silicon Biosystems using the Hamilton Microlab STARlet platform (Hamilton company, Reno, NV, USA) followed by lowpass whole genome sequencing on an Illumina NovaSeq™ platform.
4
Whole Genome Amplification and Quality Control
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA of isolated single cells was amplified using the Ampli1™ WGA-Kit (whole genome amplification) according to manufacturer’s protocol (Menarini Silicon Biosystems, Bologna, Italy). This procedure is based on a ligation-mediated PCR following a site-specific DNA restriction [54 (link)]. 1 µL of WGA products was analyzed for quality control utilizing the Ampli1™ QC-Kit (Menarini Silicon Biosystems, Bologna, Italy), which assays four genomic areas in a multiplex PCR. As positive control high quality genomic DNA from cell lines was used. QC-PCR products were loaded on a 2% agarose-TAE gel. The presence of 3 or 4 amplicons in the QC-PCR indicates a high genomic integrity of the WGA product. Less than 3 amplicons point towards a low genomic integrity [31 (link)].
5
Isolation and Whole Genome Amplification of Single Circulating Tumor Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CTCs were enriched from approximately 20 mL of whole blood by using OncoQuick (Greiner Bio-One GmbH, Frickenhausen, Germany), following the manufacturer’s instructions. Enriched CTCs were then fixed with 4% paraformaldehyde and incubated with anti-EpCAM and anti-pan-cytokeratin (CK) antibodies (CTC markers), anti-CD45 (leukocyte marker) and 4′,6-diamidino-2-phenylindole (DAPI) for nucleus staining. Samples were resuspended and loaded with SB115 manipulation buffer (Menarini Silicon Biosystems, Castel Maggiore, Italy) into A300K cartridges, and the analyses and isolation were carried out with DEPArray v1 (Menarini Silicon Biosystems). CTCs (DAPI+/EpCAM+/CK+/CD45−) and control lymphocytes (DAPI+/CD45+) were collected as pure single cells in 0.2 µL tubes. Following a phosphate-buffered saline (PBS) wash and volume reduction, single cells were subjected to whole genome amplification (WGA) by using the Ampli1™ WGA Kit (Menarini Silicon Biosystems), with a lysis step performed overnight in the thermal cycler and the others steps following the protocol provided by the manufacturer. The presence of amplified DNA was assessed by employing the Ampli1™ QC Kit (Menarini Silicon Biosystems). The products of PCR were then run on a 2% agarose gel and visualized using Chemidoc (BioRad, Hercules, CA, USA).
6
Single Cell KRAS Mutational Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target CD45−/K+ nucleated cells were picked by micromanipulation (micro injector CellTramVario and micromanipulator TransferManNKII, Eppendorf Instruments, Hamburg, Germany). Whole genome amplification (WGA) was performed with the Ampli1TM WGA kit according to the manufacturer’s instructions (Menarini Silicon Biosystems, Florence, Italy). The quality of the WGA product was assessed with the Ampli1™ QC Kit (Menarini Silicon Biosystems, Florence, Italy). KRAS Exon2 and 3 mutational analyses was performed using direct Sanger sequencing (PCR Primers: FOR: 5′TATAAGGCCTGCTGAAAATGAC; REV: 5′TTGTTGGATCATATTCGTCCAC; sequencing primers FOR: 5′GCCTGCTGAAAATGACTG; REV: CGTCCACAAAATGATTCTG).
7
Comprehensive DNA Extraction and WGA Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Genomic DNA from WBCs was isolated using the QIAamp DNA Blood Mini kit (Qiagen, Germantown, MD, USA). For bulk cancer cells, an AllPrep DNA/RNA/Protein kit (Qiagen, Germantown, MD, USA) was used as per the manufacturer’s instructions. The DNA extractions from FFPE samples were made from a 10 µm thick section using the GeneRead DNA FFPE kit (Qiagen, Germantown, MD, USA), as per the recommended instructions. The WGA of spike-in and clinical samples was conducted using the Repli-g Single cell kit (Qiagen, Germantown, MD, USA), according to the manufacturer’s protocol. For FFPE samples, the Repli-g FFPE kit (Qiagen Germantown, MD, USA) was used for WGA. All the DNA samples were quantified using a NanoDrop-2000 (ThermoFisher Scientific, Carlsbad, CA, USA) and Qubit 2.0 Fluorometer (ThermoFisher Scientific Inc., Waltham, MA, USA). WGA quality control was performed by Ampli1 QC kit (Menarini Silicon Biosystems, Huntingdon Valley, PA, USA) to check DNA integrity by conducting multiplex PCR of 4 targets at chromosome 12p, 5p, 17p, and 6p.
8
CTC Isolation and Molecular Profiling
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
CTC enrichment and enumeration were performed using the CellSearch® System and the CellSearch® Epithelial Cell Kit, and single cells, small pools of CTCs (range 8–23 cells per pool) and white blood cells (WBC) were recovered from the same CellSearch® cassettes as the single cells (Supplementary Table 1 ) using the DEPArray™ system (all Menarini Silicon Biosystems, Bologna, Italy) according to the manufacturer’s protocols, as described previously [13 (link)]. Single cells and pools of cells were amplified using the Ampli1™ WGA kit, and the presence of amplified DNA was assessed by using the Ampli1™ QC Kit (Menarini Silicon Biosystems) and assessed by multiplex PCR as described previously [13 (link)]. Only samples with a genomic integrity index (GII) ≥ 2 were analysed.
9
Whole Genome Amplification Quality Control
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We performed WGA using Ampli1 WGA Kit (Menarini-Silicon Biosystems SpA, Bologna, Italy) according to manufacturer’s instructions except for the cell lysis step, which was conducted overnight into thermal cycler. DNA samples were stocked at −20 °C until use.
All the WGA products were quality checked adopting Ampli1™ QC Kit (Menarini-Silicon Biosystems SpA, Bologna, Italy) as per manufacturer’s instructions. Briefly, we performed a multiplex PCR to amplify four amplicons of different lengths. The amplification of the regions was assessed on a 2% agarose gel using Chemidoc instrument (Bio-rad, Hercules, CA, USA). This test was performed in order to check if amplification products were appropriate for further analysis. Lack of amplification means exclusion for library preparation and sequencing.
All the WGA products were quality checked adopting Ampli1™ QC Kit (Menarini-Silicon Biosystems SpA, Bologna, Italy) as per manufacturer’s instructions. Briefly, we performed a multiplex PCR to amplify four amplicons of different lengths. The amplification of the regions was assessed on a 2% agarose gel using Chemidoc instrument (Bio-rad, Hercules, CA, USA). This test was performed in order to check if amplification products were appropriate for further analysis. Lack of amplification means exclusion for library preparation and sequencing.
10
Isolation and Amplification of Prostate Cancer CTCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Prostate cancer CTCs and lymphocytes were isolated by laser microdissection. Giemsa (Millipore, Billerica, MA, USA) was used to stain the filters, allowing single CTCs and lymphocytes to be identified and isolated by Laser Microdissection Olympus IX microscope MMI CellCut (MMI GmbH—Molecular Machines & Industries, Eching, Germany) (Figure 1 ). Once isolated at the single-cell level, CTCs underwent whole-genome amplification (WES). The DNA of isolated CTCs and lymphocytes was amplified using the Ampli1™ WES kit (Menarini Silicon Biosystems, San Diego, CA, USA) according to the manufacturer’s instructions. Briefly, reactions conducted in the same tube followed these steps: Cell lysis, DNA digestion, ligation, and primary PCR according to the procedure of the supplier, resulting in a final volume of 50 µL of WES product. Genome integrity and quality were evaluated using the Ampli1™ QC kit (Menarini Silicon Biosystems San Diego, CA, USA) and PCR products were visualized via 1.5% agarose gel.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!