Rotor gene q

Quantitative real-time PCR was performed on the Qiagen Rotor-Gene^® Q, using the BioRad iTaq^™ Universal SYBR^® Green Supermix kit. Triplicate PCR reactions were performed following the manufacturer's recommended amplification conditions. For all the analyses, the amplification of GADPH transcripts has been used as reference for normalization. The final PCR products were quantified using ΔΔCt method. The following primer pairs were used:
LRRK2 (fw GATTTCACCATTCAGAAACTC and rv CATGACATTTTTAAGGCTTCC)
GADPH (fw TCACCATCTTCCAGGAGCGAG and rv ACAGCCTTGGCAGCACCAGT)

RT-qPCR was carried out using iScript ™ One-Step RT-PCR Kit with SYBR® Green (Bio-Rad Laboratories, CA) on Rotor-Gene Q real-time PCR cycler. The primers (Life Technologies) used for the target genes: Bax gene, CASP-3 gene, TP53INP1 gene and the housekeeping gene β-actin are listed in S1. Data from real-time PCR were used to calculate the relative expression of tested genes mRNA. For the normalization of all values; the β-actin gene was utilized. Finally, values were reported as fold change using Eq. (4):³¹ $$2^{\mathrm{\Delta }\mathrm{\Delta }\text{CT}}.$$
For miRNA normalization, the internal control (U6 RNA) was used and the primer set for the internal control was purchased from RiboBio Co., Ltd. All samples were run in triplicate and the relative expression of miR‑221 was quantified by the same method.

The LAMP assay reactions were performed in triplicate to test the efficacy of three different heating devices (Qiagen Rotor-Gene Q, Bio-Rad 100 thermocycler, and dry bath). Eleven fresh bacterial colonies, including D. fangzhongdai strains (CFBP8607^T and PL145-PL150) and D. aquatica (LMG27354), D. lacustris (LMG30899), D. undicola (LMG30903), and D. oryzae (A5410) were grown on DPA/NA medium. Colonies were suspended in PCR tubes containing 100 μl of nuclease free water, boiled using the thermocycler at 95 °C for 10 min, and cooled; cooled colonies were centrifuged at full speed for 2 min. One μl of each supernatant was used as a template for LAMP reactions. The thermocycler conditions for LAMP assay were the same as the dry bath, 65 °C for 20 min.