Lipoteichoic acid lta from staphylococcus aureus

Epinecidin-1 (GFIFHIIKGLFHAGKMIHGLV-NH2; Epi) peptide was purchased from GL Biochem (Shanghai, China). Lipopolysaccharide (LPS) from Escherichia coli O111:B4, Lipoteichoic acid (LTA) from Staphylococcus aureus, MG132 and Heclin were purchased from Sigma. Epi was dissolved in dissolved in normal saline. LPS and LTA were dissolved in distilled water. MG132 and Heclin were dissolved in DMSO.

The following PRR agonists were used as controls in various experiments: synthetic triacylated lipopeptide CysSerLys₄ (Pam₃CSK₄, a TLR1/TLR2 agonist, InvivoGen); Lipopolysaccharide from Escherichia coli K12 strain (LPS-EK) and Salmonella minnesota (LPS-EM) (both ultrapure TLR4 agonists, InvivoGen); Lipoteichoic acid (LTA) from Staphylococcus aureus (TLR2/TLR6 agonist, Sigma-Aldrich); CL264 (TLR7 agonist, InvivoGen); zymosan from Saccharomyces cerevisiae (zymosan crude/ZymC, TLR2 and Dectin-1 agonist, Sigma-Aldrich); zymosan depleted from S. cerevisiae (zymosan purified/ZymP, InvivoGen); and laminarin from Laminaria digitata (Dectin-1 ligand, Sigma-Aldrich). The PRR agonists were used alone or in combination with 20 ng/mL mouse recombinant IFN-γ (Peprotech).

For RNA preparation and western blotting analysis, adherent cells (2 × 10⁶ cells) in 6-well plates were incubated with harmine for 12 h and then stimulated with 100 ng/mL LPS (serotype 055:B5, Sigma), 50 μg/mL poly(I:C) (Sigma), 10 μg/mL lipoteichoic acid (LTA) from Staphylococcus aureus (Sigma), or 2 μM phosphorothioate-modified CpG oligonucleotide(tccatgacgttcctgacgtt)(Integrated DNA Technologies, Coralville, IA, USA) for the indicated time shown in the figure legends. In some assays, 0.5 ng/mL IFN-γ (BD Pharmingen, San Diego, CA, USA) was used for priming. For supernatant collection, adherent cells (5 × 10⁵ cells) in 24-well plates were incubated with harmine for 12 h and then stimulated with 100 ng/mL LPS or poly(I:C) for the indicated time shown in the figure legends.