Chargeswitch pcr clean up kit

Manufactured by Thermo Fisher Scientific

Sourced in United States, United Kingdom

The ChargeSwitch PCR Clean-Up Kit is a product designed to purify PCR amplicons. It utilizes charge-based separation technology to remove unwanted reaction components, such as primers, nucleotides, and salts, from the desired PCR product.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Clean-up kit (5 citations) PCR clean-up (3 citations)

43 protocols using chargeswitch pcr clean up kit

Visualization of Plasmid DNA Stability

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Cy3-labeled probe for the plasmid encoding dCas9-DNMT3A was prepared using Nick Translation Kit (Roche, Indianapolis, Indiana, USA) and subsequently purified with the ChargeSwitch PCR Clean-Up Kit (Invitrogen, Paisley, UK) according to the manufacturer's protocols. For detection of genomic DNA, the centromeric chromosome 7 enumeration probe was used (Vysis CEP7 SpectrumGreen; Abbott Molecular, Des Plaines, IL, USA). At each time point, mock-transfected cells and cells transfected with BACH2-sgRNA8 and BACH2-sgRNA8 ANV were analyzed. Chromosome slides containing the mixture of probes specific for the plasmid and the chromosome 7 were denatured together at 85°C for 5 min and hybridized at 37°C overnight. The next day, slides were washed three times in preheated 0.1x saline sodium citrate (SSC) buffer at 65°C and mounted with anti-fade Fluorescence Mounting Medium (Dako) containing 8 μg/ml DAPI. The images were acquired using Olympus BX51 microscope. Number of signals per cell representing plasmid DNA encoding dCas9-DNMT3A was determined on each slide and used as approximate value for evaluation of plasmid DNA stability.

Vojta A., Dobrinić P., Tadić V., Bočkor L., Korać P., Julg B., Klasić M, & Zoldoš V. (2016). Repurposing the CRISPR-Cas9 system for targeted DNA methylation. Nucleic Acids Research, 44(12), 5615-5628.

+ Open protocol

+ Expand

Rubella Virus Genotyping Protocol

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNAs from nested RT-PCR positive reactions were purified using the Charge Switch PCR Clean-Up kit (Invitrogen Carlsbad, CA). The 739 nt sequences of the standard window used for genotyping RVs were determined bi-directionally using Applied Biosystems Prism BigDye Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) and a 3130 DNA sequencer (Applied Biosystems). Assembly of sequences was performed with Sequencher V5.2.3 (Gene Codes, Ann Arbor, MI). Genotype assignments were made using an alignment of sequences from the DRC and the 32 WHO reference virus sequences [WHO, 2013 (link)] using the neighbor joining algorithm of the MEGA6 program [Tamura et al., 2013 (link)]. Rubella sequences from the neighboring countries of Sudan [Omer et al., 2010 (link)], Uganda [Namuwulya et al., 2014 (link)], and Tanzania [Centers-for-Disease-Control-and-Prevention, 2013 (link)] were also used in this analysis. Rubella sequences from this study were deposited on GenBank under accession numbers KU218397-KU218404.

Pukuta E., Waku-Kouomou D., Abernathy E., Illunga B.K., Obama R., Mondonge V., Dahl B.A., Maresha B.G., Icenogle J, & Muyembe J.J. (2016). Genotypes of Rubella Virus and the Epidemiology of Rubella Infections in the Democratic Republic of the Congo, 2004–2013. Journal of medical virology, 88(10), 1677-1684.

+ Open protocol

+ Expand

Torsionally Constrained DNA Constructs

Check if the same lab product or an alternative is used in the 5 most similar protocols

The torsionally constrained DNA constructs were ~21 kb in length, which corresponded to a contour length of 6.8 μm. They were generated using the plasmid Supercos1-Lambda 1,2 generated in E. coli cells as previously described³⁴. To avoid damaging the final DNA substrate (20,666 bps), a Chargeswitch Plasmid miniprep kit (Invitrogen) was used to extract the plasmid. The plasmid was then double-digested using NotI and XhoI sites and purified again using a Chargeswitch PCR clean-up kit (Invitrogen). Once digested, the segments were ligated (T4 DNA ligase, NEB) to DNA linker fragments (~550 bp) that had biotinylated and digoxigenated dUTP moieties incorporated via PCR^{35 (link)}. The beads (1 μm Dynal MyOne, Invitrogen 650-01) were prepared as follows. They were washed in 0.1 M Borate buffer (H₃BO₃) at pH 9.5 and incubated under constant overnight shaking with DIG antibody Fab fragments (Roche diagnostics GmbH) in PBS at 37 °C. Excess fragments were washed away using Tris-HCl buffer and stored for months in the same at 4 °C^{33 (link)}. The bead stock was sonicated for 1 min and mixed prior to dilution in the experimental buffer (either PBS or gyrase buffer).

Agarwal R, & Duderstadt K.E. (2020). Multiplex flow magnetic tweezers reveal rare enzymatic events with single molecule precision. Nature Communications, 11, 4714.

+ Open protocol

+ Expand

Characterization of Pro2 Antisense Transcripts

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR of cDNA was used to isolate copies of transcripts from Pro2ⁱ using a Pro2ⁱ exon forward primer (5’-GGACTTTCAATCTGTCTTTGCTG) and Exon 3 reverse primer (5’-GAGTTGCCAGGATACTGAACAC). Rare antisense (as) transcripts were isolated using a nested PCR scheme first using a set of outer primers: asPro2 forward 1 (5’-GAAGATAGAGAAGACACACTCCTG), asPro3 forward 1 (5’-CAAAAACCCTGACATGGACTGATCC), asExon3 reverse 1 (5’-GTATAGTCATGTGTAGTTTCCTGTG) and as Exon2 reverse (5’-CCTCATGACTAAGGATGCTGAAC). The ChargeSwitch PCR Clean-Up Kit (Invitrogen, Carlsbad, CA, USA) was used to remove these primers from the products of first round of the nested PCR and these products were then used as the template for a second round of PCR using an inner primer set: asPro2 forward 2 (5’-GAAGACACACTCCTGCAGAGAGG), asPro3 forward 2 (5’-GGACTGATCCCAATTTCCATCAC), asExon3 reverse 2 (5’-CTGTGATCTTCAGTTTTGAAGTGG), and the same asExon2 reverse primer as the first round. Extension steps of PCRs for antisense transcripts were performed at 65°C to prevent the polymerase from prematurely detaching from a long poly-A region in antisense exon 2. The identities of transcripts were confirmed by cloning PCR products into the TOPO TA Cloning PCR 2.1 vector (Invitrogen) and sequencing.

McCullen M.V., Li H., Cam M., Sen S.K., McVicar D.W, & Anderson S.K. (2016). Analysis of Ly49 gene transcripts in mature NK cells supports a role for the Pro1 element in gene activation, not gene expression. Genes and immunity, 17(6), 349-357.

+ Open protocol

+ Expand

Insect Species Identification via PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR products were examined for correct size by agarose gel (2.5%) (Sigma-Aldrich) electrophoresis in 1X TAE buffer. Successively, amplicons were purified using a commercial purification kit (ChargeSwitch PCR Clean-Up Kit, Invitrogen, Grand Island, NY) and sequenced (ABI Prism 310 Genetic Analyser, Applied Biosystems, Foster City, CA) to confirm the identity of the insect species and of the PCR amplified products. The chromatograms of the nucleotide sequences obtained were submitted for BLAST analysis.

Tramuta C., Gallina S., Bellio A., Bianchi D.M., Chiesa F., Rubiola S., Romano A, & Decastelli L. (2018). A Set of Multiplex Polymerase Chain Reactions for Genomic Detection of Nine Edible Insect Species in Foods. Journal of Insect Science, 18(5), 3.

+ Open protocol

+ Expand

cDNA Purification using Charge Switch

Check if the same lab product or an alternative is used in the 5 most similar protocols

The Invitrogen Charge Switch PCR Clean-up Kit was used according to the manufacturer’s protocol. Briefly, binding of cDNA was achieved when 50 µl of the purification buffer and 50 µl PCR product together with 10 µl of the Charge Switch magnetic beads were mixed in a microcentrifuge tube and incubated at room temperature for one minute. The mixture was then placed on a Magna rack and the supernatant was removed and discarded. The complementary DNA (cDNA) bound to the beads was washed twice using 150 µl wash buffer for each sample. The sample was again removed from the rack and 50 µl of the elution buffer was added. The beads and buffer were mixed by gentle pipetting. The mixture was placed back on the Magna Rack and incubated for 1 min. The supernatant which contained the purified cDNA was collected, quantified using nanodrop, and stored at − 20 °C.

Nanteza M.B., Bakamutumaho B., Tushabe P., Namuwulya P., Birungi M., Dhatemwa R., Eliku J.P., Tibanagwa M., Kakooza P., Bukenya H., Bwogi J, & Byabamazima C.R. (2023). Sabin polio virus protein 1 (VP1) evolution in patients with acute flaccid paralysis from 2010 to 2016 in Uganda. Virology Journal, 20, 172.

+ Open protocol

+ Expand

16S rDNA Amplification and Sequencing

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

A colony of each isolate was cultured in tryptic soy broth incubated at 30 °C with 150 rpm agitation for 24 h. The DNA was extracted using the Fenol-Chloroform method [18 (link)]. The 16S rDNA was amplified using the PCR method with primers 1492R (TACGGYTACCTTGTTACGACT) 27F (GAGAGTTTGATCCTGGCTCA) [20 (link)]. The PCR products were purified with Charge Switch™ PCR Clean-Up Kit (Invitrogen™, Carlsbad, CA, USA) then sequenced and ran on the ABI 3730XL capillary DNA. A contiguous sequence was constructed with forward and reverse sequencing data resulting in a fragment of approximately 900 bp, with DNA Baser Sequence Assembler v4 (2013) (Heracle BioSoft, Arges, Romania).

Vasconcelos A.L., Andreote F.D., Defalco T., Delbaje E., Barrientos L., Dias A.C., Gabriel F.A., Bernardino A.F, & Núñez-Montero K. (2022). Mucilaginibacter sp. Strain Metal(loid) and Antibiotic Resistance Isolated from Estuarine Soil Contaminated Mine Tailing from the Fundão Dam. Genes, 13(2), 174.

+ Open protocol

+ Expand

PCR Product Purification and Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols

PCR or reverse-transcription-polymerase chain reaction (RT-PCR) products were purified using a ChargeSwitch PCR Clean-Up kit (Invitrogen), and the cleaned PCR product was directly sequenced by the Center for Quantitative Life Sciences at Oregon State University. The nucleotide sequences were analyzed with the Geneious Prime 2023 software.

Divilov K., Wang X., Swisher A.E., Yeoman P.C., Rintoul M., Fleener G.B., Schoolfield B., Langdon C, & Jin L. (2023). Ostreid herpesvirus 1 latent infection and reactivation in adult Pacific oysters, Crassostrea gigas. Virus Research, 339, 199245.

+ Open protocol

+ Expand

Mapping 5' Start Sites of KIR2DL1

Check if the same lab product or an alternative is used in the 5 most similar protocols

5’ RACE was performed on human donor NK cell RNA using the FirstChoice® RLM-RACE kit (Ambion Inc, Austin, TX, USA). KIR2DL1 gene-specific cDNA was generated using a KIR2DL1 Exon 3 reverse primer: 5’-CAATGAGGCGCAAAGTGTCGTTAAAC-3’. First round PCR amplification was performed using the 5’ outer adapter and the KIR2DL1-Exon 3 reverse primer 5’-CTCTCTGTGCAGAAGGAAGTGTT-3’ at an annealing temperature of 59° C for 35 cycles with Platinum PCR Supermix (Invitrogen). Excess primers from first round PCR reactions were removed with the Charge-Switch PCR Clean-Up Kit (Invitrogen). Nested PCR was subsequently performed with the 5’ inner adapter primer and the KIR2DL1-Alternate exon 2 reverse primer (5’-CCAGCCTCTATAGGCCACCTGC-3’) or a reverse primer upstream of the proximal promoter start sites (5’-TAGTGTCCTTCACTATGACCAAC-3’) at an annealing temperature of 60° C for 30 cycles. PCR products were cloned into pCR2.1 Topo (Invitrogen) and sequences analyzed to map the 5’ start sites.

Wright P.W., Li H., Huehn A., O’Connor G.M., Cooley S., Miller J.S, & Anderson S.K. (2014). Characterization of a weakly expressed KIR2DL1 variant reveals a novel upstream promoter that controls KIR expression. Genes and immunity, 15(7), 440-448.

+ Open protocol

+ Expand

5' RACE of KIR2DL2 in NK92 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

5’ RACE was performed on KIR2DL2-expressing NK92 cell RNA using the Invitrogen 5’ RACE System (Invitrogen, Carlsbad, CA, USA) following the manufacturers directions. Gene-specific cDNA was generated using a KIR2DL2/L3/S2-specific antisense primer located 147 bp upstream from the proximal promoter transcription start site (TSS): (5’-TTGACACCTTGCGTCCTTCACTAC-3’). A poly-dC tail was added to the cDNA and first round PCR amplification was performed using a poly-dG-anchor primer 5’ and a KIR2DL2 antisense primer located 294 bp upstream of the proximal TSS: (5’-GTAATGTGCAAAATGTCTAACAGG-3’) at an annealing temperature of 59° C for 35 cycles with Platinum PCR Supermix (Invitrogen). Excess primers from first round PCR reactions were removed with the Charge-Switch PCR Clean-Up Kit (Invitrogen). Nested PCR was subsequently performed with the anchor primer and a KIR2DL2 antisense primer located 366 bp upstream of the proximal TSS: (5’-TCCTGCTTGAGTTTCTAGTACTAA-3’) at an annealing temperature of 60° C for 30 cycles. PCR products were cloned into pCR2.1 Topo (Invitrogen) and sequences analyzed to map the 5’ start sites.

Li H., Wright P.W., McCullen M, & Anderson S.K. (2015). Characterization of KIR intermediate promoters reveals four promoter types associated with distinct expression patterns of KIR subtypes. Genes and immunity, 17(1), 66-74.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!