Total RNA from cultured cells of different groups was obtained by Ezol reagent (GenePharma, China), and purified via column passing method. Reverse transcription and quantitative real-time PCR (qPCR) were conducted via Hairpin-it™ microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, China) according to the manufacturer's instructions. The primer sequences for RT-qPCR were as follows: HmiR-22-3p-FO-2: 5′-3′GCGGTCAAGCTGCCAGTT and HmiR-22-3p-RE-2: 5′-3′TATGGTTGTTCACGACTCCTTCAC. U6 forward: 5′-3′CGCTTCGGCAGCACATATAC and reverse: 5′-3′TTCACGAATTTGCGTGTCATC.
Hairpin it microrna
Manufactured by GenePharma
Sourced in China
Hairpin-it™ microRNA is a lab equipment product designed for the detection and analysis of microRNA (miRNA) molecules. It provides a platform for the identification and quantification of miRNA expression levels in biological samples.
Automatically generated - may contain errors
Lab products found in correlation
U6 snrna normalization rt pcr quantitation kit, by GenePharma (9 mentions)
Trizol reagent, by Thermo Fisher Scientific (4 mentions)
Trizol reagent, by Takara Bio (3 mentions)
Ezol reagent, by GenePharma (1 mentions)
M mlv reverse transcriptase rnase h kit, by GeneCopoeia (1 mentions)
Abi stepone real time pcr system, by Thermo Fisher Scientific (1 mentions)
Primescript rt reagent kit, by Takara Bio (1 mentions)
Sybr premix ex taq, by Takara Bio (1 mentions)
Light cycler kit, by Takara Bio (1 mentions)
Bestar sybrgreen qpcr mastermix, by DBI Bioscience (1 mentions)
Transcriptor first strand cdna synthesis kit, by Roche (1 mentions)
Avian myeloblastosis virus transcriptase, by Takara Bio (1 mentions)
Random primer, by Takara Bio (1 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Goscript reverse transcription system, by Promega (1 mentions)
Gotaq qpcr master mix, by Promega (1 mentions)
Primescript rt master mix perfect, by Takara Bio (1 mentions)
Mirna mimic, by GenePharma (1 mentions)
7500 real time pcr system, by Thermo Fisher Scientific (1 mentions)
11 protocols using hairpin it microrna
1
Quantitation of microRNA-22-3p Expression
2
Real-Time PCR Analysis of miRNA-31-5p
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNAs were isolated from PAECs using the TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.). First-strand cDNAs were synthesized using the M-MLV Reverse Transcriptase (RNase H) kit (GeneCopoeia, Inc.), according to the manufacturer's protocols. Real-time PCR reactions were conducted on an ABI StepOne Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientiifc, Inc.) using the recommended reaction conditions in the manufacturer's protocols. The primers were synthesized by Shanghai GenePharma Co., Ltd. and summarized in Table II . The abundance of miRNA-31-5p was quantified by Hairpin-it microRNA and RNU6 snRNA Normalization RT-PCR Quantitation kit (Shanghai GenePharma Co., Ltd.). Additionally, GAPDH was used as the internal control for mRNA and lncRNA, and U6 was used as the internal control for miRNA. Data were analyzed using the 2−ΔΔCt method (25 (link)).
3
Quantifying miR-491-5p and IGF2 in CRC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
TRIzol Reagent (Thermo Fisher Scientific) was employed to extract total RNA from CRC tissues, cells and plasma following manufacturer’s instructions. Hairpinit™ microRNA and U6 snRNA normalization RT-PCR quantitation kit (GenePharma) were employed to detect miR-491- 5p expression levels. The IGF2 mRNA levels were assessed using PrimeScript RT reagent Kit and SYBR Premix Ex Taq (Takara, Dalian, China). All results were normalized to U6, GAPDH, and Caenorhabditis elegans miR-39 (cel-miR-39) was employed as internal control for plasma samples. The relative expression of miIR-491-5p or IGF2 mRNA was quantified using the 2−∆∆Ct method.
4
Quantification of miR-335-5p Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the miRNeasy mini kit (cat. no. 217004; Qiagen, Inc.), according to the manufacturer's instructions. Reverse transcription and RT-qPCR for the expression of miR-335-5p was performed using a Hairpin-it™ microRNA and U6 snRNA Normalization RT-PCR Quantitation kit (Shanghai GenePharma Co., Ltd.) on an ABI 7700 PCR Instrument (Applied Biosciences; Thermo Fisher Scientific, Inc.). The conditions used for reverse transcription reaction according to the manufacturer's protocols were: 25°C for 30 min, 42°C for 30 min, 85°C for 5 min and hold at 4°C. The following primers were used: hsa-miR-335-5p, forward 5′-CGTCCTCGTCAAGAGCAATAAC-3′, reverse 5′-TATGCTTGTTCTCGTCTCTGTGTC-3′; and hU6, forward 5′-CAGCACATATACTAAAATTGGAACG-3′ and reverse 5′-ACGAATTTGCGTGTCATCC-3′. The following thermocycling conditions were used for qPCR according to the manufacturer's protocols: Initial denaturation at 95°C for 3 min; followed by 40 cycles at 95°C for 12 sec and 60°C for 40 sec. U6 snRNA was used as an internal reference. The expression levels of miR-335-5p were quantified using the 2−∆∆Cq method (16 (link)) according to the manufacturer's instructions.
5
Colorectal Cancer miR-944 Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
All RNA was extracted from the CRC cell lines and colorectal tissue stored at −80°C by TRIzol reagent (Takara Bio, Otsu, Japan) following the manufacturer's instructions. Reverse transcription reactions and real‐time PCR reactions were performed by a Hairpin‐it microRNA and U6 snRNA Normalization RT‐PCR Quantitation Kit (GenePharma, Shanghai, China). The expression of miR‐944 was measured by a Light Cycler kit (Takara Bio) system according to the manufacturer's thermocycling conditions as follows: 95°C for 3 minutes, followed by 45 cycles at 95°C for 12 seconds and 62°C for 45 seconds. Here, U6 snRNA was used as an internal control. Fold changes (2−ΔΔCt) were used to analyse the relative expression of miR‐944. Each experiment was replicated three times.
6
Quantitative Analysis of RNA Profiles
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the plasma samples using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), as previously described (19 (link)). For miRNAs, RT-qPCR was performed using a Hairpin-it microRNA and U6 snRNA Normalization RT-PCR Quantitation kit (Shanghai GenePharma Co., Ltd., Shanghai, China). The conditions for the RT reaction were as follows: 30 min incubation at 25°C, 30 min at 42°C and 5 min at 85°C. The PCR conditions were 40 cycles of 12 sec at 95°C and 40 sec at 62°C. lncRNA-cDNA transcripts were amplified using a Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics, Basel, Switzerland), according to the manufacturer's protocol. The RT conditions were as follows: 60 min at 50°C and 5 min at 85°C. PCR was performed with Bestar SYBR Green qPCR Master Mix DBI Bioscience (Ludwigshafen, Germany) and the conditions were as follows: 40 cycles of 10 sec at 95°C, 30 sec at 60°C and 30 sec at 72°C. All reactions were performed in triplicate. The expression levels of miRNAs and lncRNAs relative to U6 and β-actin were respectively determined using the 2−ΔΔCq method (19 (link)). The primers used are listed in Table II .
7
Quantifying miR-372 Expression in Endometrial Carcinoma
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from endometrial carcinoma cell lines and tissues with TRIzol reagent (Takara, Shiga, Japan) and was reverse transcribed to cDNA using an avian myeloblastosis virus transcriptase and random primers (Takara, Shiga, Japan) according to the manufacturer's protocol. Then the cDNA was amplified by real-time quantitative PCR with SYBR Premix Ex Taq ™ II kit (Takara, Shiga, Japan). The expression level of each target gene was normalized to 18s mRNA. The data analysis was calculated according to the sample threshold cycle (Ct) value from three independent experiments. Hairpin-it™ microRNA and U6 snRNA Normalization RT-PCR Quantitation (GenePharma) were used to check mature miR-372.
8
Quantitative Analysis of miR-4651 in GMSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA from GMSCs was extracted by using TRIzol (Invitrogen). The levels of miR-4651 in GMSCs were detected by using a Hairpin-it microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, Suzhou, China). Two-microgram aliquots of RNA were reverse-transcribed into cDNA with random hexamers or oligo(dT) and reverse transcriptase according to the manufacturer’s instructions (Invitrogen). Then, real-time PCR was performed as previously described.54 (link) GAPDH and U6 were used to normalize mRNA and miRNA levels, respectively. Primer sequences are listed in Table 1 .
Primers sequences used in the real-time RT-PCR
| Gene symbol | Primer sequence (5′-3′) |
|---|---|
| GAPDH-F | CGGACCAATACGACCAAATCCG |
| GAPDH-R | AGCCACATCGCTCAGACACC |
| HMGA2-F | ACCCAGGGGAAGACCCAAA |
| HMGA2-R | CCTCTTGGCCGTTTTTCTCCA |
9
Quantitative Analysis of RNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using TRIzol reagent (Takara, Japan). The mRNA and lncRNA (3 µg) were reverse transcribed for the synthesis of cDNA using a GoScript Reverse Transcription system (A5001, Promega, USA). The miRNA RT assay was conducted using the Hairpin-it microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma, China). The expression status of mRNA and lncRNA were measured on an ABI QuantStudio 3 using GoTaq® qPCR Master Mix (A6001, Promega, USA), and the expression of GAPDH was used as an internal control. In addition, the expression status of miRNA was measured on an ABI QuantStudio 3 using Hairpin-it microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit, and the expression of U6 was used as an internal control. For mRNA and lncRNA, the PCR system was 20 μL, and the following procedures were performed: 40 cycles were performed at 95 °C for 3 min, 95 °C for 15 s, and 60 °C for 1 min. The dissolution curve program is: 95 °C 15 s, 60 °C 1 min, 95 °C 1 s. For miRNA, the following procedures were performed: 40 cycles were performed at 95 °C for 3 min, 95 °C for 12 s, and 62 °C for 40 s. The relative expression level of the target gene was calculated by 2−△△CT. The primer sequences showed in Supplementary Table 4 .
10
Quantifying Gene Expression in AML Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
AML cells were transfected with siRNAs or miRNA mimic (GenePharma, Shanghai, CN) using Lipofectamine® RNAiMAX Reagent (Invitrogen, CA, USA) and then identified by quantitative polymerase chain reaction (qPCR) analysis. The sequences of siRNAs and miRNAs were shown in Additional file 1 : Table S2. Total RNA was extracted from AML cells using TRIzol (Sigma, MO, USA) and further transcribed into cDNA using PrimeScript™ RT Master Mix (Perfect Real Time) (Takara, Japan). Then, the cDNA was amplified using TB Green®Premix Ex Taq II (Takara) on a 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). MiR-143 was determined using Hairpin-it™ microRNA and U6 snRNA Normalization RT-PCR Quantitation Kit (GenePharma). The mRNA levels of protein-coding genes were normalized to GAPDH endogenous control and calculated according to the Pfaffl method [28 (link)]. Primers (Sangon Biotech, Shanghai, CN) were shown in Additional file 1 : Table S3.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!