Quantitect sybr green pcr master mix

Manufactured by Thermo Fisher Scientific

Sourced in United States

The QuantiTect SYBR Green PCR Master Mix is a ready-to-use solution for quantitative real-time PCR (qPCR) analysis. It contains SYBR Green I dye, DNA polymerase, and necessary reagents for efficient DNA amplification and detection.

Automatically generated - may contain errors

Lab products found in correlation

7 protocols using quantitect sybr green pcr master mix

Quantification of PRSS1, SPINK1 mRNA Levels

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA (1 μg) was extracted and reverse-transcribed with the GoScript Reverse Transcription System. Real-time PCR was performed using QuantiTect SYBR Green PCR Master Mix (Applied Biosystems) in triplicate and analyzed on an ABI 7500 Fast Real-Time PCR system (Applied Biosystems). Human PRSS1, SPINK1, and GAPDH mRNA levels were quantified by reverse transcription PCR (RT-PCR) and real-time qPCR. The PRSS1 primer sequences were as follows:
forward, 5′-AGGCACACTCTACCACCATGA-3′; reverse, 5′-ATGTTGTGCTCTCCCAGTCTCA-3′. The SPINK1 primer sequences were as follows: forward, 5′-AACAGGCATCTTTCTTCTCAGTG-3′; reverse, 5′-TTGGGATAAGTATTTCCATCAGTC-3′. The GAPDH primer sequences were as follows: forward, 5′-TGAAGGTCGGAGTCAACGGAT-3′; reverse, 5′-CTGGAAGATGGTGATGGGATT-3′.

Tan Z., Gao L., Wang Y., Yin H., Xi Y., Wu X., Shao Y., Qiu W., Du P., Shen W., Fu L., Jia R., Zhao C., Zhang Y., Zhao Z., Sun Z., Chen H., Hu X., Xu J, & Wang Y. (2020). PRSS contributes to cetuximab resistance in colorectal cancer. Science Advances, 6(1), eaax5576.

+ Open protocol

+ Expand

Quantification of miR-125a-5p and target genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the cells (or tissues) using TRIzol (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s protocol. For miR-125a-5p quantitative PCR, cDNA was synthesized with TaqMan MicroRNA hsa-miR-125a-5p specific primers (Applied Biosystems) using the TaqMan MicroRNA Reverse Transcription kit (Applied Biosystems). qRT-PCR was performed in duplicate using QuantiTect SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) and analyzed on an ABI Prism 7500 analyzer (Applied Biosystems, Foster City, CA). The primers used were as follows: A20, forward, 5′-AAAGCCCTCATCGACAGAAA -3′, reverse, 5′-CAGTTGCCAGCGGAATTTA-3′; TRAIL, forward, 5′-accaacgagctgaagcagat-3′, reverse, 5′-cagcaggggctgttcatact-3′; and GAPDH, forward, 5′-GGAGTCAACGGATTTGGT-3′, reverse, 5′-GTGATGGGATTTCCATTGAT-3′.

Zhang H., Huang C., Wang Y., Lu Z., Zhuang N., Zhao D., He J, & Shi L. (2015). Hepatitis B Virus X Protein Sensitizes TRAIL-Induced Hepatocyte Apoptosis by Inhibiting the E3 Ubiquitin Ligase A20. PLoS ONE, 10(5), e0127329.

+ Open protocol

+ Expand

Quantifying Myogenic Differentiation Markers

Check if the same lab product or an alternative is used in the 5 most similar protocols

mRNA was extracted from scaffolds after 9 days of culture in differentiation media using an RNeasy Plant Mini kit following the manufacturer's instructions. RNA was then reverse transcribed to cDNA using the QuantiTect Reverse Transcription kit at 1 μg per reaction. Quantitative real‐time PCR reactions were performed in triplicate using a Step One Plus Real‐Time PCR system (Applied Biosystems) and QuantiTect SYBR Green PCR master mix. All primer sequences were derived from an online primer bank and synthesized by Integrated DNA Technologies. Expression of the following markers was quantified: mouse myosin heavy chain 2 (Myh2), AAGTGACTGTGAAAACAGAAGCA and GCAGCCATTTGTAAGGGTTGAC; mouse myogenic differentiation factor 1 (Myod1), ATCCGCTACATCGAAGGTCTG and CTCGACACAGCCGCACTCTTC; and mouse glyceraldehyde 3‐phosphate dehydrogenase (Gapdh), AGGTCGGTGTGAACGGATTTG and TGTAGACCATGTAGTTGAGGTCA. Fold changes in gene expression (normalized to the CG group at day 2) were calculated using the delta–delta Ct method with Gapdh as the housekeeping gene.

Basurto I.M., Muhammad S.A., Gardner G.M., Christ G.J, & Caliari S.R. (2022). Controlling scaffold conductivity and pore size to direct myogenic cell alignment and differentiation. Journal of Biomedical Materials Research. Part a, 110(10), 1681-1694.

+ Open protocol

+ Expand

Quantitative Real-Time PCR for Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

The total RNA was isolated using TRIzol reagent according to the manufacturer’s instructions. cDNA was generated with oligo (dT)₁₅ primers (Promega Corporation, Madison, WI, USA). RT-qPCR was performed with Applied Biosystems 7500 real time PCR system using QuantiTect SYBR Green PCR Master mix (Applied Biosystems, Carlsbad, CA, USA). For normalization the housekeeping gene GAPDH was applied as a reference gene. The primer sequences are as follows: Forward: 5′-TGGCTCAGCCAGATGCAGT-3′ and reverse: 5′-ATTGGGATCATCTTGCTGGTG-3′ for MCP-1; PAI-1, forward: 5′-AACCCAGGCCGACTTCA-3′ and reverse: 5′-CATGCGGGCTGAGACTAGAAT-3′ for PAI-1; and forward: 5′-GGCAAATTCAACGGCACAGT-3′ and reverse: 5′-AGATGGTGATGGGCTTCCC-3′ for GAPDH. The comparative Ct (cycle threshold) method, also referred to as the 2^−ΔΔCT method, was used to quantify the gene expression. The relative gene expression was expressed as the ratio of CNP-treated to non-CNP-treated samples.

LI Z.Q., LIU Y.L., LI G., LI B., LIU Y., LI X.F, & LIU A.J. (2014). Inhibitory effects of C-type natriuretic peptide on the differentiation of cardiac fibroblasts, and secretion of monocyte chemoattractant protein-1 and plasminogen activator inhibitor-1. Molecular Medicine Reports, 11(1), 159-165.

+ Open protocol

+ Expand

Quantitative Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted with RNeasy Mini kits (QIAGEN) and cDNA was reverse transcribed using a Maxima First Strand cDNA Synthesis Kit (Thermo Fisher Scientific). The expression of genes was determined using QuantiTect SYBR Green PCR master mix (Thermo Fisher Scientific) and a Real Plex2 Mastercycler (Eppendorf). The primers used are listed in Table S1. Gene transcript numbers were standardized and adjusted relative to β-actin transcripts.

Shirai T., Nazarewicz R.R., Wallis B.B., Yanes R.E., Watanabe R., Hilhorst M., Tian L., Harrison D.G., Giacomini J.C., Assimes T.L., Goronzy J.J, & Weyand C.M. (2016). The glycolytic enzyme PKM2 bridges metabolic and inflammatory dysfunction in coronary artery disease. The Journal of Experimental Medicine, 213(3), 337-354.

+ Open protocol

+ Expand

Quantitative Detection of Mycoplasma genitalium

Check if the same lab product or an alternative is used in the 5 most similar protocols

The QIAamp DNA Mini Kit (Cat. No. 51304; Qiagen, Hilden, Germany) was utilized for DNA extraction from the tracheal samples following the recommendations of the manufacturer. Absolute quantification of MG populations was carried out in the Stratagene MX3005P RT-PCR recognition system (Cat. No. PF1457N; Thermo Fisher, CA), in triplicate, using the QuantiTect SYBR Green PCR Master Mix (Cat. No. 204143; Qiagen, Hilden, Germany) according to the instructions of the manufacturer. The sequence of the primer used in the qPCR assay targeting mgc2 gene of MG is as follows: F-CGCAATTTGGTCCTAATCCCCAACA and R-TAAACCCACCTCCAGCTTTATTTCC (Awad et al., 2022 ). The standard calibration curves for qPCR were generated via 10-fold serial dilutions of the DNA samples extracted from pure MG cultures. The target genomic DNA copies were determined and MG quantities were expressed as log₁₀ colony forming units (CFU)/gram of the samples.

Hashem Y.M., Abd El-Hamid M.I., Awad N.F., Ibrahim D., Elshater N.S., El-Malt R.M., Hassan W.H., Abo-Shama U.H., Nassan M.A., El-Bahy S.M., Samy O.M., El Sharkawy R.B., Algabri N, & Elnahriry S.S. (2022). Insights into growth-promoting, anti-inflammatory, immunostimulant, and antibacterial activities of Toldin CRD as a novel phytobiotic in broiler chickens experimentally infected with Mycoplasma gallisepticum. Poultry Science, 101(11), 102154.

+ Open protocol

+ Expand

Quantitative microRNA Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA contained microRNA was isolated and purified using the miRNeasy Mini Kit (Qiagen, USA) according to the manufacturer’s instructions. RNA was quantified and qualified using Nanodrop spectrophotometer (Thermo Scientific) by 260/230 nm ratio. Reverse transcription was performed using miScript II RT Kit (Qiagen) as described in the manufacturer’s protocol. Real-time RT-PCR was performed using miScript SYBR Green PCR Kit (Qiagen) contained 2× QuantiTect SYBR Green PCR Master Mix and universal microRNA primer on QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). We used specific commercially available primers (Qiagen) for hsa-miR-21, has-miR-29c, and adjusted by Primer-BLAST and OligoArchitect primers (RNU6, CGCAAGGATGACACGCAAAT, Evrogen). Expression levels of miRs were calculated relative to RNU6 levels by the comparative ΔCT method.

Basalova N., Sagaradze G., Arbatskiy M., Evtushenko E., Kulebyakin K., Grigorieva O., Akopyan Z., Kalinina N, & Efimenko A. (2020). Secretome of Mesenchymal Stromal Cells Prevents Myofibroblasts Differentiation by Transferring Fibrosis-Associated microRNAs within Extracellular Vesicles. Cells, 9(5), 1272.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!