Therneasy mini kit

Manufactured by Qiagen

Sourced in Germany, United Kingdom

The RNeasy Mini Kit is a versatile tool for the isolation and purification of total RNA from a variety of biological samples. It utilizes a silica-based membrane technology to efficiently capture and purify RNA, while removing contaminants and inhibitors.

Automatically generated - may contain errors

Lab products found in correlation

Qiashredder homogenizer, by Qiagen (1 mentions) Superscript first strand synthesis system, by Thermo Fisher Scientific (1 mentions) Trizol reagent, by Thermo Fisher Scientific (1 mentions) Amv 1st strand cdna synthesis kit, by Roche (1 mentions) Lightcycler 480 system, by Roche (1 mentions) Thehigh capacity rna to cdna kit, by Thermo Fisher Scientific (1 mentions) Sybr green jumpstart readymix, by Merck Group (1 mentions) Improm 2 reverse transcription system, by Promega (1 mentions) Rnase free dnase 1, by Thermo Fisher Scientific (1 mentions) Sureprint g3 human gene expression 8x60k v2 microarray, by Agilent Technologies (1 mentions) Gene expression hybridization kit, by Agilent Technologies (1 mentions) Rna 6000 nano labchip kit, by Agilent Technologies (1 mentions) Myiq thermal cycler, by Bio-Rad (1 mentions) M mlv reverse transcriptase, by Promega (1 mentions) Iq sybr green supermix kit, by Bio-Rad (1 mentions) Steponeplus real time pcr instrument, by Thermo Fisher Scientific (1 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (1 mentions) Low input quick amp labeling kit, by Agilent Technologies (1 mentions) Quantstudio 3 real time pcr, by Thermo Fisher Scientific (1 mentions) Ethidium bromide, by Merck Group (1 mentions)

11 protocols using therneasy mini kit

Quantitative Real-Time PCR Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from whole cells with QIAshredder Homogenizers and the
RNEasy Mini kit (Qiagen). cDNA was reverse transcribed from total RNA samples
using iScript cDNA Synthesis Kit with 1 μg of RNA template. qRT-PCR was
carried out using iQ SYBR Green Supermix and a CFX384 Touch Real-Time PCR
Detection System, according to manufacturer instructions. Fold expression was
determined by normalizing cycle threshold (C_q) values to
ACTB reference gene and normalizing samples to control
sample, in accordance with the ΔΔC_q method.
For primers, see Supplementary Table 5.

Lin K.H., Rutter J.C., Xie A., Pardieu B., Winn E.T., Bello R.D., Forget A., Itzykson R., Ahn Y.R., Dai Z., Sobhan R.T., Anderson G.R., Singleton K.R., Decker A.E., Winter P.S., Locasale J.W., Crawford L., Puissant A, & Wood K.C. (2020). Using antagonistic pleiotropy to design a chemotherapy-induced evolutionary trap to target drug resistance in cancer. Nature genetics, 52(4), 408-417.

+ Open protocol

+ Expand

RNA Extraction and Real-Time PCR Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Tumors were harvested at the time of euthanasia, snap-frozen,
homogenized in liquid nitrogen and dissolved in TRIzol reagent (Life
Technologies). Total RNA was extracted in chloroform and purified using the
RNeasy Mini kit (Qiagen). cDNA was generated from 1 μg RNA using the
SuperScript First-strand Synthesis System (Life Technologies) and used for
real-time PCR (Supplemental
Table I). SYBR Green PCR Master mix (Applied Biosciences) was used
according to the manufacturer’s instructions. Data were analyzed
according to the comparative threshold method and normalized against the GAPDH
internal control transcript.

Steinberger K.J., Bailey M.T., Gross A.C., Sumner L.A., Voorhees J.L., Crouser N., Curry J.M., Wang Y., DeVries A.C., Marsh C.B., Glaser R., Yang E.V, & Eubank T.D. (2020). Stress-induced Norepinephrine Downregulates CCL2 in Macrophages to Suppress Tumor Growth in a Model of Malignant Melanoma. Cancer prevention research (Philadelphia, Pa.), 13(9), 747-760.

+ Open protocol

+ Expand

Hepatic CYP gene expression analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

TheRNeasy Mini Kit (Qiagen, Hilden, Germany) was used to extract total RNA from 100 mg samples of fresh frozen liver. RNA was reverse transcribed using the AMV 1st Strand cDNA Synthesis Kit (Roche, Indianapolis, IL). The resulting cDNA templates were used to measure expression levels of 17 cytochrome P450 (CYP) isoforms (Supplementary Table 1) by qPCR in a Roche Lightcycler 480 System as described [29 (link)]. Primer pairs were designed using Mac Vector 12 software (Cary,NC). Relative mRNA abundance was calculated using the 2^ΔΔCt method with results normalized to Hypoxanthine-guanine phosphoribosyltransferase (HPRT) and Beta-actin (Actβ) as internal controls.

Yalcin E., Tong M, & de la Monte S. (2016). Enzymatic Responses to Alcohol and Tobacco Nicotine-Derived Nitrosamine Ketone Exposures in Long Evans Rat Livers. Austin liver, 1(1), 1003.

+ Open protocol

+ Expand

Quantifying Metabolic Enzyme Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

MCF-7 or LCC9 cells were collected and total RNA was isolated using the
RNeasy Mini Kit (Qiagen). One microgram of RNA was converted to cDNA using the
High-Capacity RNA-to-cDNA kit (appliedbiosystems) according to the
manufacture’s protocol. Samples were then analyzed for qPCR via the
TaqMan Fast Advanced (appliedbiosystems) system with human probes for PSAT1
(Hs00795278_mH), PHGDH (Hs00198333_m1), and ACTB (Hs01060665_g1).

Metcalf S., Petri B.J., Kruer T., Green B., Dougherty S., Wittliff J.L., Klinge C.M, & Clem B.F. (2021). Serine Synthesis Influences Tamoxifen Response in ER+ Human Breast Carcinoma. Endocrine-related cancer, 28(1), 27-37.

+ Open protocol

+ Expand

Osteoclast Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was purified from different stages of osteoclast cultures using the
RNeasy Mini Kit (QIAGEN). Gene expression was calculated using the Δ-ΔCt
method (using the mean cycle threshold value for ubiquitin and the gene of interest for
each sample. The equation 1.8e(Ct ubiquitin – Ct gene of interest) ×
10⁴ was used to obtain the normalized values.

ADAMOPOULOS I.E., SUZUKI E., CHAO C.C., GORMAN D., ADDA S., MAVERAKIS E., ZARBALIS K., GEISSLER R., ASIO A., BLUMENSCHEIN W.M., McCLANAHAN T., DE WAAL MALEFYT R., GERSHWIN M.E, & BOWMAN E.P. (2014). IL-17A GENE TRANSFER INDUCES BONE LOSS AND EPIDERMAL HYPERPLASIA ASSOCIATED WITH PSORIATIC ARTHRITIS. Annals of the rheumatic diseases, 74(6), 1284-1292.

+ Open protocol

+ Expand

Mahanine-induced transcriptome profiling in MIAPaCa-2 cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

A quantitative study was done using first strand cDNA by real-time PCR using a Light Cycler rapid thermal cycler system (Bio-Rad-Richmond, Richmond, CA) with SYBR Green Jump Start Ready mix (Sigma), following the manufacturer’s instruction. MIAPaCa-2 cell treated with mahanine (15 µM) for 18 hr. Total RNA was extracted using theRNeasy mini kit (Qiagen, Valencia, CA) and treated with a RNase free DNase I (Invitrogen) following the manufacturer’s instruction. First strand cDNA was synthesized by ImPromII-Reverse transcription system (Promega, Madison, WI). Isolated RNA was used for labeling, hybridization, and scanning of the Illumina human Sentrix 6V2 chip (San Diego, CA) in the Genomics and Proteomics Core Facility of the German Cancer Research Center according to Illumina’s recommended protocols. The Sentrix 6V2 bead chip includes an expression level of 48,600 human transcripts, variants, and EST clusters.

Sarkar Bhattacharya S., Mandal C., Albiez R.S., Samanta S.K, & Mandal C. (2018). Mahanine drives pancreatic adenocarcinoma cells into endoplasmic reticular stress-mediated apoptosis through modulating sialylation process and Ca2+-signaling. Scientific Reports, 8, 3911.

+ Open protocol

+ Expand

Microarray Analysis of MTX-Treated HFLS-RA Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Drug treatment for microarray analysis: HFLS-RA cells were seeded in
75 cm² culture flasks for 24 hours prior to treatment. Cells were
treated with IC₅₀ concentrations of MTX. The untreated cells
(control) and MTX-treated cells were harvested after 48 hours and stored in
RNAprotect Cell Reagent (Qiagen, Manchester, UK) at −80°C.
Total RNA isolation, purity and integrity: Total RNA was isolated using the
RNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Total RNA
(100 ng) was spiked with in vitro–synthesized polyadenylated transcripts
(One-Color RNA Spike-In Mix, Agilent Technologies, Santa Clara, CA, USA). The
spiked total RNA was reverse transcribed into complementary DNA (cDNA) and then
converted into Cyanine-3–labelled cRNA (Low Input Quick-Amp Labelling Kit
One-Color, Agilent Technologies).
Microarray Hybridization: The quality of labelled non-fragmented cRNA was
analysed on a 2100 Bioanalyzer using RNA 6000 Nano LabChip Kit (Agilent
Technologies). Each Cyanin-3–labelled cRNA sample (600 ng) was fragmented,
hybridized at 65°C for 17 hours, and separated using Agilent SurePrint G3 Human
Gene Expression 8x60K v2 Microarrays (AMADID 039494) with one-color–based
hybridization (Gene Expression Hybridization Kit, Agilent Technologies).

Shervington L., Darekar A., Shaikh M., Mathews R, & Shervington A. (2018). Identifying Reliable Diagnostic/Predictive Biomarkers for Rheumatoid Arthritis. Biomarker Insights, 13, 1177271918801005.

+ Open protocol

+ Expand

Quantifying Gene Expression via qPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using the
RNeasy Mini Kit (Qiagen, Valencia,
CA) and reverse transcribed by employing M-MLV reverse transcriptase
(Promega, Madison, WI) and a poly(dT) primer. Quantitative real-time
PCR was performed with iQ SYBR green supermix kit (Bio-Rad, Hercules,
CA) on a Bio-Rad MyiQ thermal cycler, and gene-specific primers are
listed in Supporting Information Table S5. The comparative cycle threshold method was utilized for the relative
quantification of gene-expression level, and GAPDH gene was used as the internal control. The mRNA level of each gene
was normalized to that of the internal control.^{20 (link)}

Prins J.M., Fu L., Guo L, & Wang Y. (2014). Cd2+-Induced Alteration of the Global Proteome of Human Skin Fibroblast Cells. Journal of Proteome Research, 13(3), 1677-1687.

+ Open protocol

+ Expand

Quantitative Real-Time RT-PCR for Gene Expression

Cited 3 times

Check if the same lab product or an alternative is used in the 5 most similar protocols

The purification of high-quality RNA from cells was performed using The RNeasy Mini Kit (74104, QIAGEN) in accordance with the manufacturer’s protocols. Samples were performed in triplicates. SYBR Green PCR Master Mix (4309155, Applied Biosystems) was used for two-step real-time RT-PCR analysis on an Applied Biosystems StepOnePlus Real Time PCR instrument. Expression value of the targeted gene in a given sample was normalized to the corresponding ex pression of GAPDH. The 2^-ΔΔCt method was used to calculate relative expression of the targeted genes. The primers were: GAPDH-F, 5’- AGCCTCAAGATCATCAGCAATG’, GAPDH-R 5’- TGATGGCATGGACTGTGGTCAT −3’, hPin1-F, 5’-GCCTCACAGTTCAGCGACT-3’, hPin1-R, 5’-ACTCAGTGCGGAGGATGATGT-3’, hENT1-F, 5’-CAGAAAGTGCCTTCGGCTAC-3’ , hENT1-R, 5’-TGGGCTGAGAGAGTTGGAGACT-3’, hPD-L1-F, 5’-TGGCATTTGCTGAAC GCATTT-3, hPD-L1-R, 5’-TGCAGCCAGGTCTAATTGTTTT-3’ (Zhang et al., 2018 (link)), hPD-L1 −2F, 5’-GGTGCCGACTACAAGCGAAT-3’, hPD-L1–2R, 5’-AGCCCTCAGCCTGACATGTC-3 ‘ (Burr et al., 2017 (link)), hPD-L1–3F, 5’-ATTTGGAGGATGTGCCAGAG-3’, hPD-L1–3R, 5’-CCAG CACACTGAGAATCAACA-3’ (Mezzadra et al., 2017 (link)), hPD-L1–4 F, 5’- CCTACTGGCATTTG CTGAACGCAT-3’, hPD-L1–4 R, 5’- ACCATAGCTGATCATGCAGCGGTA-3’

Koikawa K., Kibe S., Suizu F., Sekino N., Kim N., Manz T.D., Pinch B.J., Akshinthala D., Verma A., Gaglia G., Nezu Y., Ke S., Qiu C., Ohuchida K., Oda Y., Lee T.H., Wegiel B., Clohessy J.G., Sanatagata S., Wulf G.M., Hidalgo M., Muthuswamy S., Nakamura M., Gray N.S., Zhou X.Z, & Lu K.P. (2021). Targeting Pin1 Renders Pancreatic Cancer Eradicable by Synergizing with Immunochemotherapy. Cell, 184(18), 4753-4771.e27.

+ Open protocol

+ Expand

RNA Amplification and Labeling

Check if the same lab product or an alternative is used in the 5 most similar protocols

A Low Input Quick Amp Labeling Kit was used to amplify the total RNA, as well as
to label the total RNA by One-Color (Agilent Technologies). Subsequently, the
RNeasy Mini Kit (QIAGEN GmbH) was used to purify the labeled complementary
RNAs.

Shi F., Liu Y., Li M., Wen P., Qian Q.Q., Fan Y, & Huang R. (2019). Analysis of lncRNA and mRNA Transcriptomes Expression in Thyroid Cancer Tissues Among Patients With Exposure of Medical Occupational Radiation. Dose-Response, 17(3), 1559325819864223.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!