Cfx connect real time pcr detection system

Total RNA was isolated using TRIzol Reagent (Life Technologies) according to the supplier’s protocol. cDNA synthesis was performed with 1 µg of total RNA using the SuperScript III First Strand Synthesis Supermix for qRT-PCR kit (Invitrogen), according to the supplier’s protocol. Real-time PCR was performed using a Bio-Rad CFX Connect Real-Time PCR Detection System in conjunction with the Maxima SYBR Green qPCR Master Mix kit (Thermo Scientific). Primers specific for caf5 (forward: 5′-CTC AGC TTG CAA AGG AAA CC-3′, reverse: 5′-GGC ACC CAC GAG AAT ACC TA-3′), trr1 (forward: 5′-TCT TTC TCG CCC TTT CA-3′, reverse: 5′-GGC ACC ATC ACA TAC AGC AC-3′), and the control housekeeping gene gpd1 (forward: 5′-TCT GCC GGT ATC CAA CTT TC-3′, reverse: 5′-CAC TGC AAA CGA CAA CGA CT-3′) were used. Relative expression levels were determined using the 2^−ΔΔCt method of Livak and Schmittgen (2001) (link). Statistical analysis was performed using one-way ANOVA.

Total RNA was extracted from samples equivalent to those used for the dual-luciferase assays using TRIzol Reagent (Themo Fisher Scientific, 15596018) and Direct-zol RNA Miniprep (Zymo Research, R2050) according to the manufacturer’s instructions. cDNA was prepared from equal amounts of RNA using PrimeScript RT Reagent Kit (Takara, RR037A) following manufacturer’s instructions. qPCR was performed using PowerUp Sybr Green Master Mix (Thermo Fisher Scientific, A25742) to amplify the cDNA on the CFX Connect Real-Time PCR Detection System at the annealing temperature of 63 °C. Relative firefly luciferase mRNA levels were normalized to relative expression levels of the RPS18 gene that was used as an internal control. Primers used for firefly luciferase were FF-F: GAGCTATTCTTGCGCAGCTT and FF-R: CCTCACCTACCTCCTTGCTG; primers for RPS18 were RPS18-F: GATGGGCGGCGGAAAATAG and RPS18-R: GCGTGGATTCTGCATAATGGT.

Total RNA for the experiments was extracted from the cells using GENEzol™ TriRNA Pure Kit + DNAse (Geneaid HyLabs, Taiwan) according to the manufacturer’s protocol. Quantification of total RNA concentration was done using NanoDrop ND-1000 spectrophotometer (Version 3.8.1, Thermo Fisher). First strand cDNA synthesis was done from 1000 ng of RNA using qScript cDNA Synthesis kit (Quantabio, USA). RT qPCR was performed using Fast SYBR™ Green Master Mix (Applied Biosystems™, Thermo Fisher) and a CFX Connect™ Real-Time PCR Detection System. Primer sequences (HyLabs and IDT) are listed in Table S3. Relative expression of the transcripts was normalized to Hypoxanthine Phosphoribosyltransferase (HPRT)1 or Ubiquitin C (UBC), and the gene expression was quantified based on comparative 2^-ΔΔCT.

Independent experiments of 5-10 larvae from each group were stored at −80°C before homogenizing in TRI Reagent (Sigma-Aldrich). Total RNA was isolated by phenol-chloroform extraction method and purified by Total RNA Purification Mini Kit (Favorgen Biotech, Taiwan, China). RNA concentration was measured by spectrophotometer (BMG LABTECH, NC, USA) at 260 nm and a total amount of 2 µg RNA was used for reverse transcription to cDNA using a High-Capacity cDNA Reverse Transcription Kit (Thermo Fisher Scientific Baltics, Vilnius, Lithuania). Quantification of mRNA levels was performed by SYBR-Green-based gene expression analysis using a CFX connect real-time PCR detection system (Applied Biosystems, CA, USA). The samples were amplified by 40 cycles of 15 s at 95°C and 1 min at 60°C. Housekeeping gene Rp49 was used as a loading control. The primer sequences are as follows (5′-3′): Nmnat (forward): GGCCAGTCGGTCAAGTACC, Nmnat (reverse): CGGTGCATCCCGCGATTT, Rp49 (forward): CTAAGCTGTCGCACAAATGGC, Rp49 (reverse): AACCGATGTTGGGCATCAGA.

Animal tissues and intracellular total RNA were extracted using the standard TRIzol method (Invitrogen, USA). It is then reversed into cDNA using the iScript cDNA synthesis kit (Bio-Rad). qPCR was performed using a mirVana™ qRT-PCR miRNA Detection Kit (Invitrogen, USA) and SYBR Premix Ex Taq™ II kit (TaKaRa, Japan). The samples were loaded in triplicate on a CFX Connect™ Real-time PCR Detection System (Applied Biosystems, Foster City, CA, USA). Data were analyzed using the Bio-Rad CFX software. GAPDH (for mRNAs) and U6 (for microRNAs) were used as internal controls for normalization. The sequences of the PCR primers are shown in Table 1.

RT-qPCR analysis of mRNA abundance was performed on a BioRad CFX Connect Real-time PCR detection system, using Power SYBR Green RNA-to-CT 1-Step Kit (Applied Biosystems) for 40 cycles. Expression values relative to 18S rRNA expression were calculated using CFX Manager Software. Quantitative PCR of viral genome copies utilized host cell GAPDH gene copy number as control. To quantitate mitochondrial DNA copy number, total cellular DNA was extracted using the DNAeasy kit (Qiagen). Quantitative PCR was then performed on 10 ng input DNA using MT-ND2 (mtDNA)-specific and AluYb8 (nuclear DNA)-specific primers. C_t values obtained from AluYb8 amplification were used for normalization. A list of PCR primers used can be found in the Key Resources Table.

RNA extraction, cDNA synthesis, RT−PCR, and RT−qPCR were performed as previously reported (Gutjahr et al., 2008 (link)). Total RNA was extracted from 100 mg shoot or root tissue by using TRIzol Reagent (Invitrogen™) following the manufacturer’s instructions. For the following gene expression analysis, genomic DNA was removed from total RNA using DNase I (RNase-free, Invitrogen™). After DNase I treatment, purified RNA samples were reverse transcribed using the Moloney murine leukemia virus reverse transcriptase kit (Invitrogen™) with oligo (dT) primers for cDNA synthesis. The RT-qPCRs were performed with SYBR^® Green Supermix (2X) (Bio-Rad) on a CFX Connect Real-Time PCR Detection System (Applied Biosystems) as described in the manufacturer’s protocol. Transcript levels were normalized to constitutively expressed Cyclophilin2 (Gutjahr et al., 2008 (link)). The RT−qPCR primers were designed using Primer3 web version 4.1.0 (http://primer3.ut.ee/). All RT−qPCR primers are listed in Supplementary Table S9.