Log In Sign up
The largest database of trusted experimental protocols

L dna analyzer

Manufactured by Thermo Fisher Scientific
Visit Supplier
Sourced in United States

The 3730 × l DNA Analyzer is a high-performance capillary electrophoresis instrument designed for DNA sequencing and fragment analysis applications. It features 96 or 384 capillary arrays and can process multiple samples simultaneously.

Automatically generated - may contain errors

Lab products found in correlation

Cleanseq system, by Beckman Coulter (4 mentions) Abi 9800 fast thermo cyclers, by Beckman Coulter (4 mentions) Bigdye terminator v3.1 cycle sequencing kit, by Thermo Fisher Scientific (3 mentions) Gotaq master mix, by Promega (2 mentions) Nuclease free water, by Promega (2 mentions) Qiaquick pcr purification kit, by Qiagen (2 mentions) Geneamp pcr system 9700, by Thermo Fisher Scientific (2 mentions) Type it microsatellite pcr kit, by Qiagen (2 mentions) Peak scanner software 2, by Thermo Fisher Scientific (2 mentions) Aligner, by CodonCode (2 mentions) Veriti thermal cycler, by Thermo Fisher Scientific (2 mentions) Bigdye version 3, by Thermo Fisher Scientific (1 mentions) Pcr clean up system, by Promega (1 mentions) Pgem t easy, by Promega (1 mentions) Wizard sv gel, by Promega (1 mentions) Bigdye terminator cycle sequencing ready reaction kit, by Thermo Fisher Scientific (1 mentions) Ex taq, by Takara Bio (1 mentions) Dneasy blood tissue kit, by Qiagen (1 mentions) Casava pipeline, by Illumina (1 mentions) Masterpure yeast dna purification kit, by Illumina (1 mentions)

Close spelling variants of this product

ABI 3730×l DNA Analyzer (11 citations) ABI Prism 3730×l DNA Analyzer (2 citations) ABI Prism 3130×l DNA Analyzer (2 citations)

29 protocols using l dna analyzer

1

Genetic Variation Analysis of ABCA1 Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR primers were designed to cover the coding sequences, plus a few nucleotides in the intron on both ends (Table 2). Primer extension sequencing was performed by GENEWIZ, Inc. (South Plainfield, NJ, USA) using Applied Biosystems Big Dye version 3.1. Both forward and reverse strands were sequenced. The reactions were run on Applied Biosystem’s 3730×L DNA Analyzer.

The SNPs, SNPs Position And Primers Sequences For ABCA1 Gene

SNP-IDChrBpPrimer ForwardPrimer Reverse
rs24724939107,695,848ATTTGACTGCAGTGGGTGAGTCAAGAGGTTAGCCTTGGCT
rs24870329107,703,934TTTGCCTTTGCATGGTTTTACCAAACCCATAAGAGCCTGA

Abbreviations: Bp, base pair (Genomic Position); Chr, chromosome.

Alkhatib R., Abudhaim N., AL-Eitan L., Abdo N., Alqudah A, & Aman H. (2019). Genetic Analysis Of ABCA1 Gene Of Primary Glaucoma In Jordanian Arab Population. The Application of Clinical Genetics, 12, 181-189.
+ Open protocol
+ Expand
2

Molecular Cloning and Sequencing of OCT/Tyr Gene

Check if the same lab product or an alternative is used in the 5 most similar protocols
The OCT/Tyr PCR amplicons were purified with Wizard® SV Gel and a PCR Clean-up System (Promega, Madison, WI, USA) according to the manufacturer’s instruction. The gene was ligated in pGEM-Teasy (Promega, Madison, WI, USA) at 4 °C overnight and transformed into ECOSTM competent Escherichia coli DH5α (Nipon gene, Tokyo, Japan). For each sample, successful clones were confirmed by colony PCR and at least 4 colonies were multiplied in Luria-Bertaini broth (with 100 µg/mL ampicillin) and purified using a NucleoSpin® Plasmid Easy Pure kit (Marcherey-Nagel, Duren, Germany) following the manufacturer’s instruction. The OCT/Tyr gene insert was sequenced with T7 promoter (forward) primer using a BigDye v3.1 Terminator Cycle Sequencing Kit and the 3730 × l DNA Analyzer (Applied Biosystem, Waltham, MA, USA).
Vudriko P., Umemiya-Shirafuji R., Tayebwa D.S., Byaruhanga J., Byamukama B., Tumwebaze M., Xuan X, & Suzuki H. (2022). Molecular Characterization of Octopamine/Tyramine Receptor Gene of Amitraz-Resistant Rhipicephalus (Boophilus) decoloratus Ticks from Uganda. Microorganisms, 10(12), 2384.
+ Open protocol
+ Expand
3

Taeniid Proglottid DNA Extraction and cox1 Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Genomic DNA samples were extracted from individual taeniid proglottids using a DNeasy Blood & Tissue kits (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The complete cox1 gene (1,620 bp) was amplified by PCR using the primers Taenia trnW/F (5′-GTT ATG TTA GAC TAG ATG TTT TCA-3′ for the Taenia transfer RNA-Try gene) and Taenia rrnl/R (5′-TCC ACT AAG CAT AAT GCA AAA GGC-3′ for Taenia ribosomal RNA large subunit gene) [18 (link)]. TaKaRa Ex Taq (Hot Start version, Takara Bio, Shiga, Japan) was used as a DNA polymerase. PCR amplification consisted of an initial denaturation step of 98 °C for 30 s, followed by 35 cycles of 94 °C for 30 s, 58 °C for 30 s, 72 °C for 90 s, with a final cycle of 72 °C for 5 min. Amplicons were cleaned using ExoSAP-IT (Affimetrix/USB, Santa Clara, CA, USA) and used as templates for direct DNA sequencing. Samples for DNA sequencing were prepared using a BigDye Terminator Cycle Sequencing Ready Reaction kit (Life Technologies, Foster City, CA, USA) by primer walking and run on a 3730 × l DNA Analyzer (Life Technologies, Carlsbad, CA USA).
Sanpool O., Rodpai R., Intapan P.M., Sadaow L., Thanchomnang T., Laymanivong S., Maleewong W, & Yamasaki H. (2017). Genetic diversity of Taenia saginata (Cestoda: Cyclophyllidea) from Lao People’s Democratic Republic and northeastern Thailand based on mitochondrial DNA. Parasites & Vectors, 10, 141.
+ Open protocol
+ Expand
4

Targeted Sequencing and Mutation Validation

Check if the same lab product or an alternative is used in the 5 most similar protocols
RTA (Real Time Analyses) software version 1.13.48 took data from the sequence raw images to Illumina’s BCL format binary files for base calls and quality scores. BCL files were converted to FASTQ files dimultiplexed by Illumina’s CASAVA pipeline version 1.8.2. We used the GATK (Genome Analysis Toolkit, Broad Institute, Cambridge, MA, USA) structured programming framework to obtain rich sets of data access patterns, base quality score recalibration, indel realignment, duplicate removal, and SNP and INDEL discovery [28 (link)]. To validate detected mutations, the LEP gene exon 3 encoding region (ENST00000308868.4) was amplified by PCR. The amplicon was purified by alkaline phosphatase and exonuclease I, and directly sequenced all along its length by the Sanger method [29 (link)]. Each person’s sequence was compared to the reference wild type sequence. Nucleotide numbering was begun at the first adenine (A) of the ATG start codon in position 1. In summary, the targeted amplicons of each sample were sequenced on MiSeq in 300 bp paired-end reads. The potential causative variants identified by targeted sequencing were confirmed by Sanger sequencing via the 3730 × l DNA Analyzer (Life Technologies, Carlsbad, CA, USA).
Yupanqui-Lozno H., Bastarrachea R.A., Yupanqui-Velazco M.E., Alvarez-Jaramillo M., Medina-Méndez E., Giraldo-Peña A.P., Arias-Serrano A., Torres-Forero C., Garcia-Ordoñez A.M., Mastronardi C.A., Restrepo C.M., Rodriguez-Ayala E., Nava-Gonzalez E.J., Arcos-Burgos M., Kent JW J.r., Cole S.A., Licinio J, & Celis-Regalado L.G. (2019). Congenital Leptin Deficiency and Leptin Gene Missense Mutation Found in Two Colombian Sisters with Severe Obesity. Genes, 10(5), 342.
+ Open protocol
+ Expand
5

Fungal DNA Extraction and Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA extraction was performed using the cetyltrimethylammonium bromide protocol (Su et al. 2019) (link) and MasterPure TM Yeast DNA Purification Kit (Epicentre, Madison, WI, U.S.A.). The quantity and quality of the isolated DNA were evaluated using a NanoDrop ND-1000 spectrophotometer with the ND-1000 v3.3.0 software (Coleman Technologies, Wilmington, NC, U.S.A.). Five gene regions; the rDNA internal transcribed spacer (ITS), D1-D2 region of large subunit (LSU), partial β-tubulin (TUB), translation elongation factor 3 (TEF3) and ribosomal protein 60S L10 (L1) (RP60S) were amplified using the primers ITS4-ITS5, LR0R-LR5, TUB2Fd-TUB4Fd, EF3-3185F / EF3-3538R and 60S-908R / 60S506F, respectively (de Hoog et al. 2017; (link)Dukik et al. 2017) (link). PCRs were carried out as described by Stielow et al. (2015) (link). PCR products were visualized on 1.5% agarose gels and cycle-sequenced using Applied Biosystems BigDye Terminator version 3.1 (Thermo Fisher Scientific) after purification. Bidirectional sequencing was performed using a capillary electrophoresis system (3730×l DNA analyzer; Life Technologies, Carlsbad, CA, U.S.A.). Obtained sequences were manually inspected and stored in a BIOLOMICS database.
Kandemir H., Dukik K., Teixeria M.d.M., Stielow J.B., Delma F.Z., Al‐Hatmi A.M.S., Ahmed S., İlkit M., & Hoog S.d. (2021). Phylogenetic and ecological reevaluation of the order Onygenales.
+ Open protocol
+ Expand
6

Bacterial 16S rRNA Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
PCR was performed for candidate dependents, helpers, and other isolates using the general bacterial primers 27F (5’-AGAGTTTGATCMTGGCTCAG-3’) and 1492R (5’-GGTTACCTTGTTACGACTT-3’) to amplify the 16S rRNA gene. The PCR reaction mixture was 12.5 μL GoTaq Master Mix (Promega), 1 μL 10 μM 27F and 1492R primers (Operon), 9.5 μL Nuclease Free Water (Promega), and 1 μL of a colony resuspended in 100 μL sterilized distilled water. The amplification conditions were one cycle of 95 °C for 5 min; 30 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 90 s; and finally one cycle of 72 °C for 7 min. Amplification of PCR reactions were confirmed using gel electrophoresis on a 0.8% agarose gel containing ethidium bromide. Successful PCRs were sequenced by Macrogen Corporation using the 27F and 1492R primers using the Applied Biosystems 3730×l DNA analyzer. Quality control for sequences was performed using DNA Baser (www.DnaBaser.com, version 4.36.0), in which ends were trimmed until there were more than 75% good bases (defined by having a QV score of higher than 25) in an 18 base window. Identification of phylogenetic neighbors and calculation of pairwise sequence similarity were done using the EZTaxon server (http://www.eztaxon.org). The phylogenic tree for KLE1738 was built using the Randomized Axelerated Maximum Likelihood (RAxML) method43 (link) via PATRIC44 (link) (version 3.5.23).
Strandwitz P., Kim K.H., Terekhova D., Liu J.K., Sharma A., Levering J., McDonald D., Dietrich D., Ramadhar T.R., Lekbua A., Mroue N., Liston C., Stewart E.J., Dubin M.J., Zengler K., Knight R., Gilbert J.A., Clardy J, & Lewis K. (2018). GABA Modulating Bacteria of the Human Gut Microbiota. Nature microbiology, 4(3), 396-403.
+ Open protocol
+ Expand
7

Validation of kdr Allele Genotyping

Check if the same lab product or an alternative is used in the 5 most similar protocols
DNA sequencing was performed to validate the PCR-based genotyping used for various kdr alleles and also to check for the presence of any novel mutation. Three regions of VGSC were amplified and sequenced: (i) partial domain II (P to S6) using primers IIP_F and IIS6_R [26] (link), (ii) partial domain III (S4–S6) using primers Ge-IIIS6_F and IIIS6R [26] (link), and (iii) partial domain IV (S5–S6) using primers 5380F1 and 5380R1 [27] . PCR products were amplified, purified using QIaquick PCR purification kit (Qiagen Inc) and subjected to cycle sequencing reaction using BigDye Terminator v3.0. The termination products were run in Applied Biosystems 3730×l DNA Analyzer. Some of the sequencing reactions were performed at Macrogen Inc (South Korea). Sequencing chromatograms were edited using FinchTV ver 1.5.0 (Geospiza, Inc.). The PCR product of one sample, which was suspected to have an indel in the intron, was cloned in pGEM-T vector system using vendor's protocol and five clones were sequenced. Sequences were aligned using ClustalW implemented in Mega5 [28] .
Kushwah R.B., Dykes C.L., Kapoor N., Adak T, & Singh O.P. (2015). Pyrethroid-Resistance and Presence of Two Knockdown Resistance (kdr) Mutations, F1534C and a Novel Mutation T1520I, in Indian Aedes aegypti. PLoS Neglected Tropical Diseases, 9(1), e3332.
+ Open protocol
+ Expand
8

Genomic Breakpoint Determination by LR-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
To determine the genomic breakpoints of the deletion, long-range polymerase chain reaction (LR-PCR) was carried out using the Bio-X-ACT long DNA polymerase (Bioline, London, UK) and the manufacturer's suggested protocol. The following primers were used to amplify across the 4p15.32 deletion: BST1-F 5’-GCT GAG TCA AGG ACA GAA GAC AT-3’ and CD38-R 5’-TAG GCA GAA GGA ATA AGC GTC AC-3’. PCR products were purified using exonuclease I (NEB, Ipswich, MA) and shrimp alkaline phosphatase (USB, Cleveland, OH). Bidirectional Sanger sequencing was then performed using BigDye chemistry (Applied Biosystems) and run on a 3730 × l DNA Analyzer (Applied Biosystems).
Ceroni F., Sagar A., Simpson N.H., Gawthrope A.J., Newbury D.F., Pinto D., Francis S.M., Tessman D.C., Cook E.H., Monaco A.P., Maestrini E., Pagnamenta A.T, & Jacob S. (2014). A Deletion Involving CD38 and BST1 Results in a Fusion Transcript in a Patient With Autism and Asthma. Autism research : official journal of the International Society for Autism Research, 7(2), 254-263.
+ Open protocol
+ Expand
9

Polymerase Chain Reaction for Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols
Polymerase chain reaction (PCR) was performed on GeneAmp PCR System 9700 (Applied Biosystems, Carlsbad, CA, USA). A standardized touch down (TD-) PCR profile was used for all PCR analyses containing two cycling steps: initial denaturation for 15 min at 95°C, followed by 10 cycles of denaturation at 95°C / 30 s; annealing at 60°C / 30 s (decreasing by 0.5°C per cycle) followed by extension at 72°C / 60 s); then 35 cycles denaturation at 95°C / 30 s, annealing at 55°C / 30 s, and extension at 72°C / 60 s followed by a final extension step at 72°C / 7 min. PCR products were resolved by agarose gel electrophoresis using 1.5% agarose gel (Invitrogen GmbH, Darmstadt, Germany) strength and 1×TBE buffer. A list of primers used to amplify neighboring genes of MND as inferred by synteny to B. distachyon is given in Additional file 3: Table S6.
PCR amplicons were purified with NucleoFast 96 ultra-filtration plates (MACHEREY-NAGEL GmbH & Co. KG, Düren, Germany) and sequenced using BigDye® Terminator v3.1 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA) on the 3730 × l DNA Analyzer (Applied Biosystems, Carlsbad, CA, USA). Obtained sequence reads were analysis was done with ‘Sequencher 4’ software (Genecodes Corporation, USA).
Mascher M., Jost M., Kuon J.E., Himmelbach A., Aßfalg A., Beier S., Scholz U., Graner A, & Stein N. (2014). Mapping-by-sequencing accelerates forward genetics in barley. Genome Biology, 15(6), R78.
+ Open protocol
+ Expand
10

Gel Extraction and DNA Sequencing

Check if the same lab product or an alternative is used in the 5 most similar protocols
The PCR products were separated by electrophoresis on a 2% agarose gel. The different fragments of the expected size were extracted by using a gel extraction kit (Qiagen, Inc., Valencia, CA, USA) and subsequently sequenced directly using a 3730×l DNA Analyzer (Applied BioSystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA), according to the manufacturer's protocol.
Wang J., Ou S.W., Zhang Z.Y., Qiu B, & Wang Y.J. (2017). Molecular expression of multiple Nav1.5 splice variants in the frontal lobe of the human brain. International Journal of Molecular Medicine, 41(2), 915-923.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!