Log In Sign up
The largest database of trusted experimental protocols

Pcmv6 expression vector

Manufactured by OriGene
Visit Supplier

The PCMV6 expression vector is a plasmid designed for the expression of target genes in mammalian cells. It contains the cytomegalovirus (CMV) promoter, which drives high-level expression of the inserted gene. The vector also includes a multiple cloning site, allowing for the convenient insertion of the gene of interest.

Automatically generated - may contain errors

Lab products found in correlation

Ptarget, by Promega (2 mentions) Quikchange lightning site directed mutagenesis kit, by Agilent Technologies (1 mentions)

4 protocols using pcmv6 expression vector

1

Cloning and Tagging of Human ADAM8 cDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length human ADAM8 cDNA was obtained by reverse transcription and PCR (hA8fw 5’ ATGCGCGGCCTCGGGCTCT, hA8Sto.as 5’ CTAGGGTGCTGTGGGAGCTCCG) from AsPC1 cells. The PCR product was cloned into the expression vector pTarget (Promega) and the sequences of the ADAM8 constructs were verified by DNA sequencing. The C-terminal tagged ADAM8 constructs (EGFP, mCherry and BiPro36 (link)) were generated by PCR using cloning primers (hA8SgfI 5’GAG GCG ATC GCC ATG CGC GGC CTC GGG CTC, hA8MluI 5’ GCG ACG CGT GGG TGC TGT GGG AGC TCC) and ligated into the pCMV6 expression vector (Origene) using the MluI and SgfI restriction sites, respectively.
Schlomann U., Koller G., Conrad C., Ferdous T., Golfi P., Garcia A.M., Höfling S., Parsons M., Costa P., Soper R., Bossard M., Hagemann T., Roshani R., Sewald N., Ketchem R.R., Moss M.L., Rasmussen F.H., Miller M.A., Lauffenburger D.A., Tuveson D.A., Nimsky C, & Bartsch J.W. (2015). ADAM8 as a drug target in Pancreatic Cancer. Nature communications, 6, 6175.
+ Open protocol
+ Expand
2

Site-Directed Mutagenesis of EPCR

Check if the same lab product or an alternative is used in the 5 most similar protocols
EPCR in pCMV6 expression vector (Origene) was used for generating EPCR mutants. Mutagenesis was performed with the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent) using the primers in Table S3. Wild-type (WT) and mutant EPCR sequences were confirmed by DNA sequencing.
Sampath S., Brazier A.J., Avril M., Bernabeu M., Vigdorovich V., Mascarenhas A., Gomes E., Sather D.N., Esmon C.T, & Smith J.D. (2015). Plasmodium falciparum adhesion domains linked to severe malaria differ in blockade of endothelial protein C receptor. Cellular microbiology, 17(12), 1868-1882.
+ Open protocol
+ Expand
3

Cloning and Tagging of Human ADAM8 cDNA

Check if the same lab product or an alternative is used in the 5 most similar protocols
Full-length human ADAM8 cDNA was obtained by reverse transcription and PCR (hA8fw 5’ ATGCGCGGCCTCGGGCTCT, hA8Sto.as 5’ CTAGGGTGCTGTGGGAGCTCCG) from AsPC1 cells. The PCR product was cloned into the expression vector pTarget (Promega) and the sequences of the ADAM8 constructs were verified by DNA sequencing. The C-terminal tagged ADAM8 constructs (EGFP, mCherry and BiPro36 (link)) were generated by PCR using cloning primers (hA8SgfI 5’GAG GCG ATC GCC ATG CGC GGC CTC GGG CTC, hA8MluI 5’ GCG ACG CGT GGG TGC TGT GGG AGC TCC) and ligated into the pCMV6 expression vector (Origene) using the MluI and SgfI restriction sites, respectively.
Schlomann U., Koller G., Conrad C., Ferdous T., Golfi P., Garcia A.M., Höfling S., Parsons M., Costa P., Soper R., Bossard M., Hagemann T., Roshani R., Sewald N., Ketchem R.R., Moss M.L., Rasmussen F.H., Miller M.A., Lauffenburger D.A., Tuveson D.A., Nimsky C, & Bartsch J.W. (2015). ADAM8 as a drug target in Pancreatic Cancer. Nature communications, 6, 6175.
+ Open protocol
+ Expand
4

Engineered Cell Lines with MET Variants

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
NIH3T3 and HEK293T cells obtained from the Genentech cell bank were maintained in DMEM supplemented with 10% FBS. Clones expressing C-terminally Myc/DDK-tagged MITF, ACTG1 and MET from the pCMV6 expression vector were purchased from Origene. A construct encoding an ACTG1-MITF fusion with a C-terminal Myc/DDK tag sequence was generated using splicing by overlap PCR and cloned into pCMV6. Expression vector containing MET served as a template for the generation of the MET mutants using the QuikChange II XL site-directed mutagenesis kit (Stratagene). NIH3T3 cells stably expressing wild-type MET, the MET mutants or ACTG1-MITF were generated using retroviral constructs as previously described98 (link).
Durinck S., Stawiski E.W., Pavía-Jiménez A., Modrusan Z., Kapur P., Jaiswal B.S., Zhang N., Toffessi-Tcheuyap V., Nguyen T.T., Pahuja K.B., Chen Y.J., Saleem S., Chaudhuri S., Heldens S., Jackson M., Peña-Llopis S., Guillory J., Toy K., Ha C., Harris C.J., Holloman E., Hill H.M., Stinson J., Rivers C.S., Janakiraman V., Wang W., Kinch L.N., Grishin N.V., Haverty P.M., Chow B., Gehring J.S., Reeder J., Pau G., Wu T.D., Margulis V., Lotan Y., Sagalowsky A., Pedrosa I., de Sauvage F.J., Brugarolas J, & Seshagiri S. (2014). Spectrum of diverse genomic alterations define non–clear cell renal carcinoma subtypes. Nature genetics, 47(1), 13-21.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!