Analyses by qRT-PCR with fecal and ileal C. parvum oocyst shedding were assessed by genomic DNA extracted from fecal and ileal samples. The primers target the 18 s rRNA gene of the parasite by GenBank (www.ncbi.nlm.nih.gov/genbank/ , AF164102). The reaction was performed in a Bio-Rad iCycler iQ multicolor PCR Detection System using iCycler software (version 3.0). Amplification consisted of 15 min at 95 °C followed by 40 cycles of 15 s at 95 °C, 15 s at 52 °C, and 20 s at 72 °C, followed by 0.5-degree increments for 10 s starting at 75 °C and ending with 95 °C for the Melt Curve. Ct values of each run were compared to standards with known amounts of C. parvum DNA and log transformed into number of organisms per mg of stool sample.19 (link)
Icycler iq multicolor pcr detection system
Manufactured by Bio-Rad
Sourced in United States
The ICycler iQ multicolor PCR Detection System is a real-time PCR instrument designed for quantitative analysis of nucleic acid samples. It features a thermal cycler and a fluorescence detection system that can monitor the amplification of multiple target sequences simultaneously.
Automatically generated - may contain errors
Lab products found in correlation
Primescript kit, by Takara Bio (4 mentions)
Revertra ace qpcr rt kit, by Toyobo (4 mentions)
Sybr premix ex taq 2 2 kit, by Takara Bio (3 mentions)
Forward and reverse primer, by Thermo Fisher Scientific (1 mentions)
Iq sybr green supermix, by Bio-Rad (1 mentions)
Rna extraction kit, by Tiangen Biotech (1 mentions)
Sybr premix ex taqtm 2, by Takara Bio (1 mentions)
Trizol, by Thermo Fisher Scientific (1 mentions)
Fastking rt kit, by Tiangen Biotech (1 mentions)
Premix extaq 2 2 kit, by Takara Bio (1 mentions)
Rnase free dnase 1, by Thermo Fisher Scientific (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
12 protocols using icycler iq multicolor pcr detection system
1
Quantifying C. parvum Oocyst Shedding
2
qRT-PCR Analysis of Gene Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was extracted according to the method described by Guo et al (2012) [45 (link)]. cDNA was synthesized using Prime Script Kit (Takara, Dalian, China) following the manufacturer’s instructions. The cDNA concentration used for qRT-PCR was 50 ng/µL. The iCycleriQ™ Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA) machine was used for qRT-PCR and the procedure was designed following Zhang et al. [18 (link)]. Briefly, the qRT-PCR cycling conditions were as follows: pre-denaturation at 95 ℃ for 1 min, followed by 40 cycles of denaturation at 95 ℃ for 10 s, annealing at 56 °C for 30 s, and extension at 72 °C for 30 s. The fluorescent signal was measured at the end of each cycle, and melting curve analysis was performed by heating the PCR product from 56 to 95 °C in order to verify the specificities of the primers. The actin mRNA (CaActin2, accession No. AY572427) from pepper and the actin-97 mRNA (Nbactin-97, accession No. LOC109206422) from N. benthamiana were used as references, respectively [46 (link),47 ]. All the primer specificities used for the qRT-PCR were assessed using NCBI Primer BLAST (Supplementary Table S3 ). Three independent biological replicates were carried out. The relative expression of genes was calculated using the 2−△△Ct method described by Schmittgen and Livak (2008) [48 (link)].
3
Quantitative PCR for Cryptosporidium parvum
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Extracted DNA (5 µl) was added to a master mix (20 µl) to give a total reaction volume of 25 µl per sample. The master mix was prepared by mixing 12.5 µl of Bio-Rad iQ SYBR Green Supermix (Bio-Rad Laboratories, Hercules, California), 5.5 µl of DEPC-treated nuclease free sterile water (Fisher Scientific, Pittsburgh, Pennsylvania), and 1.0 µl (6.2 mM) each of both forward and reverse primers (Invitrogen, Carlsbad, California). The primers target the 18 s rRNA gene of the parasite as shown in Table 1
4
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated as per the procedures described by Guo et al. (2012) (link). The first strand cDNA was synthesized using the PrimeScript Kit (Takara, Dalian, China) according to the manufacturer's instructions. The cDNA concentration was diluted to 50 ng/µL and used for quantitative real-time PCR (qRT-PCR). Then, qRT-PCR was performed in triplicate on an iCycler iQ™ Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA) with the following thermal cycling program: pre-denaturation at 95°C for 1 min followed by 40 cycles of denaturization at 95°C for 10 s, annealing at 56°C for 30 s, and extension at 72°C for 30 s. All the primer specificities for qRT-PCR were assessed using NCBI Primer BLAST (Table S2
5
Quantifying Gene Expression in Watermelon Leaves
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the leaves using an RNA extraction kit (AxGen, Union City, CA, USA). Residual DNA was removed using a DNase Mini Kit (Qiagen, Hilden, Germany). The isolated total RNA (1 μg) was reverse transcribed using a ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan). qRT-PCR was then performed using an iCycler iQ Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA) as described by Li et al.17 (link). The primers used for qRT-PCR are listed in Supplementary Table S1 . The relative expression levels were standardized to those of watermelon β-ACTIN and were calculated as described by Livak and Schmittgen37 (link),38 (link).
6
Quantitative Real-Time PCR of Cold-Sensitive Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two cold-sensitive genes Cla020078 (CBF1) and Cla020702 (MYB) were chose to perform quantitative real-time PCR (qRT-PCR). Total RNA was extracted using a RNA extraction kit (Tiangen, Beijing, China) according to the supplier’s instructions. DNA contamination was removed using a purifying column. One microgram of total RNA was reverse-transcribed using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the supplier’s instructions. The gene-specific primers for qRT-PCR were designed based on their cDNA sequences, as follows: Cla020078 (F, AGCAGAGCCCTAACACAGGT; R, AATGGTCTTGAGTTGGG), Cla020702 (F, GATCCATTGACGGCACTAAC; R, TCGCTACAACGTCCTTCATC), and watermelon β-actin gene (F, CCATGTATGTTGCCATCCAG; R, GGATAGCATGGGGTAGAGCA) was used as an internal control (Kong et al., 2014 (link)). The qRT-PCR assays were performed using an iCycler Iq Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA). PCRs were performed using the SYBR Premix ExTaq II (2×) Kit (Takara, Tokyo, Japan). The PCR conditions consisted of denaturation at 95°C for 3 min, followed by 40 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. The quantification of mRNA levels was based on the method of Livak and Schmittgen (2001) (link).
7
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from collected sample after various stress treatments using Trizol (Invitrogen) method. Then the first strand cDNA was synthesized using of prime script TM kit (Takara) following the manufacturer’s protocols. The NanoDrop instrument (Thermo Scientific NanoDrop 2000C, USA) was used to measure the concentration of cDNA. Later on qRT-PCR was carried out using SYBR® Premix Ex TaqTM II (TaKaRa) in an iCycler iQTM Multicolor PCR Detection System (Bio-Rad, USA). The amplification cycling parameters of qRT-PCR were as follow: 95°C for 1 min and followed by 40 cycles at 95°C for 10 s, 56°C for 15 s, and 72°C for 15 s. All the primers used for qRT-PCR were shown in Supplementary Table S1 . Relative expression of genes was calculated as described by Livak and Schmittgen (2001) (link) and CaUbi3 gene was used as the reference gene in this study (Wan et al., 2011 (link)).
8
RNA Extraction and qRT-PCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The total RNA were isolated from the seeds using an RNA extraction kit (Axgen, Union City, CA, USA). After extraction, a DNase Mini Kit (Qiagen, Hilden, Germany) was used to remove residual DNA. Then, total RNA (1 µg per sample) was reverse-transcribed to cDNA using a FastKing RT kit (TIANGEN, Beijing, China). qRT-PCR was conducted on an iCycler Iq TM Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA) using SYBR® Premix ExTaqTM II (2×) kit (Takara, Tokyo, Japan). The gene-specific primers were designed according to the EST sequences (http://cucurbitgenomics.org/ , accessed on 1 March 2018): 5′-TTGGTGCTGGCGAATTGGTTGA-3′ and 5′-ATGATCTGAGGCAGCGGCAAA-3′ for CmCNGC20 (MELO3C001941); 5′-AGTGAGTGACAGCCGAGTTCTAAGT-3′ and 5′-CTGCTCTGTGACGGTATTGGATGAA-3′ for CmRBOHD (MELO3C026754); 5′-GCACGAGTTGAAGGCTGAGTTGA-3′ and 5′-GGAATCCATCCTTGGCGAGCTTATC’ for CmRBOHF (MELO3C005718); and 5′-ATTCTTGCATCTCTAAGTACCTTCC-3′ and 5′-CCAACTAAAGGGAAATAACTCACC-3′ for CmActin (MELO3C008032). CmActin was used as the internal control genes [30 (link)]. The relative expression of mRNA was calculated as described previously [33 (link)].
9
Watermelon Gene Expression Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using an RNA extraction kit (Axgen, Union City, CA, USA) according to the manufacturer’s instructions. Residual DNA was removed with DNase Mini Kit (Qiagen, Hilden, Germany). One microgram of total RNA was used for reverse transcription using the ReverTra Ace qPCR RT Kit (Toyobo, Osaka, Japan) following the manufacturer’s instructions. The gene-specific primers for qRT-PCR were designed on the basis of cDNA sequences as shown in Supplemental Table S1 and watermelon β-actin gene was used as an internal control56 (link). The qRT-PCR assay was performed using an iCycler Iq TM Multicolor PCR Detection System (Bio-Rad, Hercules, CA, USA). PCR products were amplified using the Premix ExTaq II (2×) Kit (Takara, Tokyo, Japan). The PCR conditions consisted of denaturation at 95 °C for 3 min, followed by 40 cycles of denaturation at 95 °C for 30 s, annealing at 58 °C for 30 s and extension at 72 °C for 30 s. The quantification of mRNA levels was performed according to the method of Livak and Schmittgen57 (link).
10
Quantitative Real-Time PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted using the RNA extraction kit from Axgen (Union City, CA, United States) according to the manufacturer’s instructions. After extraction, the RNA samples were treated with gDNase to remove DNA, then reverse-transcribed (1 μg per sample) to cDNA using a ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Quantitative Real-Time PCR was conducted using SYBR Premix ExTaqII (2×) Kit (Takara, Tokyo, Japan) on an iCycler Iq TM Multicolor PCR Detection System (Bio-Rad, Hercules, CA, United States; Li et al., 2017 (link)). β-ACTIN was used as an internal control gene. Primers used for gene expression analyses are listed in Supplementary Table S1 . The relative expression of genes was calculated using the 2−ΔΔCT method as reported in Livak and Schmittgen (2001) (link).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!