To make stable knockdown cells, MISSION NonTarget shRNA (shNT) and shRNAs specifically targeting Prx4 (shPrx4) were commercially obtained and knockdown efficiency was screened as previously published (14 (link)). To establish Prx4 KO cell lines using CRISPR-Cas9 technique, gRNAs targeting for PRDX4 gene (gRNA1: 5′-ACCTAAGCAAAGCGAAGAGT-3′, gRNA2: 5′-TACCCCAAAAGCCGCAGCTG-3′) were synthesized by Thermo Fisher Scientific. Annealed oligos were inserted into BsmbI site of the plasmid pLentiCRISPR-V2, which is a gift from Dr Feng Zhang’s lab (52961; Addgene plasmid) (53 (link)). Lentiviral particles were generated following instruction in the manual using commercial packaging plasmid mix (SHP001; Sigma–Aldrich) and Lipofectamine 3000 transfection reagent (L3000001; Thermo Fisher Scientific) in HEK293T cells. Stable cells were established and maintained in 1 μg/ml puromycin-containing medium.
Shp001
Manufactured by Merck Group
SHP001 is a compact and versatile laboratory equipment designed for various scientific applications. It is a multipurpose instrument that can perform a wide range of tasks, including sample preparation, analysis, and data collection. The core function of SHP001 is to provide reliable and accurate results, enabling researchers and scientists to conduct their experiments efficiently.
Automatically generated - may contain errors
Lab products found in correlation
Shc016, by Merck Group (2 mentions)
Shc001, by Merck Group (2 mentions)
Opti mem, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000 reagent, by Thermo Fisher Scientific (2 mentions)
Lipofectamine 3000 transfection reagent, by Thermo Fisher Scientific (1 mentions)
Mission shrna, by Merck Group (1 mentions)
Lenti x concentrator, by Takara Bio (1 mentions)
Shc002, by Merck Group (1 mentions)
Hiv 1 p24 elisa, by ZeptoMetrix (1 mentions)
Mission plko 1 puro empty vector control plasmid dna, by Merck Group (1 mentions)
Puromycin, by InvivoGen (1 mentions)
Lipofectamine 3000, by Thermo Fisher Scientific (1 mentions)
9 protocols using shp001
1
Establishing Prx4 KO Cell Lines
2
Silencing of SDF-1 in Mesenchymal Stem Cells
3
Lentiviral ROR1 Knockdown Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Validated lentiviral ROR1 shRNA (TRCN0000002026, Sigma), lentiviral packaging mix (SHP001, Sigma), and pLKO.1 (Addgene #8453) were used to obtain lentiviral particles. Briefly, 1 μg of ROR1 shRNA or pLKO.1 plasmids and 5 μL of lentiviral packaging mix were mixed with PEI (Polysciences) transfection reagent in 500 μL OptiMEM (Thermo Fisher Scientific). The mixture of plasmids and transfection reagent was incubated for 5 min and then transfected into HEK293T cells. After 48 h, the supernatant of the HEK293T cells containing viral particles was collected, filtered, aliquoted, and stored at −80 °C.
4
Lentiviral Knockdown of PTK2B in Cancer Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral PTK2B shRNA plasmids were purchased from Sigma-Aldrich (MISSION shRNA Plasmid DNA protein tyrosine kinase 2 beta (PTK2B/PYK2) SHCLND-NM_004103. 3-763S1C1 & NM_004103. 3-4018S21C1). The lentiviral packaging mix was also purchased from Sigma (SHP001). Plasmids were transfected using Lipofectamine™ 3000 Reagent (L3000001, ThermoFisher Scientific) and following manufacturer recommendations. The lentiviral particles used to infect SkBr3 and MDA-MB-453 were produced corresponding to the manufacturer recommendations and as previously described [29 (link)].
5
Lentiviral Knockdown of MAGE-A3
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Lentiviral shRNA particles targeting MAGE-A3 (shMA3) and a scrambled non-target sequence (shNT) were produced following the lentiviral packaging protocol from Sigma-Aldrich (SHP001). Low passage HEK293T cells were transfected with plasmid constructs containing the shRNA sequences targeting MAGE-A3 (TRCN0000128375 and TRCN0000129750, Sigma-Aldrich) or a non-target sequence (SHC002, Sigma-Aldrich). Viral supernatants were harvested, concentrated using Lenti-X concentrator (Clontech, 631231) and titer was obtained by HIV-1 p24 ELISA (Zeptometrix, 0801111). Optimal multiplicity-of-infection (MOI) was determined for each cell line on a lot-to-lot basis.
6
Cloning and Mutagenesis of PML-I Construct
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The PMLI gene fragment was obtained by PCR amplification from pcDNA3.1-PMLI (a kind gift from Dr Mounira Chelbi-Alix, University PARIS V) using forward primer SpeI/PML F′: 5′-CATCTAACTAGTATGGAGAGCCTGCACCCGCCC-3′ and reverse primer PML R′/BamHI 5′-CATCTAGGATCCTCAGCTCTGCTCGGAGGCC-3′ (Eurofins MWG Operon). The fragment obtained was cloned into the pLKOpuro vector using the SpeI and BamHI restriction sites (SHC001, Sigma, St Louis, MO, USA). An HA-tag was introduced in the C-terminal end of PMLI by PCR using QuikChange Site-Directed Mutagenesis Kit (200518, Stratagene, Cedar Creek, TX, USA) and the following primers: HA-tag-sense 5′-CCTCCCAGCAGAGCTACCCTATCGATGTTCCAGATTACGCTTGAGGATCCACCGG-3′ and HA-tag-antisense 5′-CCGGTGGATCCTCAAGCGTAATCTGGAACATCGTATGGGTAGCTCTGCTGGGAGG-3′. The deletions of PMLI NLS and PMLI NES were also performed by PCR using QuikChange Site-Directed Mutagenesis Kit using ΔNLS-sense 5′-GCCCCAGGAAGGTCGGGAAGGAGGCAAG-3′ ΔNLS-antisense 5′-CTTGCCTCCTTCCCGACCTTCCTGGGGC-3′ or ΔNES-sense 5′-ACATTAACAGGCTGTGGGAAGTGCCCGGGGC-3′ ΔNES-antisense 5′-GCCCCGGGCACTTCCCACAGCCTGTTAATGT-3′. The lentiviral particles used to infect DU145 and PC3 with pLKO-PML constructs were produced according to the manufacturer's recommendations. The lentiviral packaging mix was also purchased from Sigma (SHP001).
7
Silencing SDF-1 in Mesenchymal Stem Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For the silencing of SDF‐1, target sequence CATCAGTGACGGTAAACCAGTC(consortium number TRCN0000195944), or a scrambled (SCR) control sequence (SHC016) were obtained from Sigma‐Aldrich (St. Louis, MO, USA). Lentiviral particles were generated using a commercially available packaging mix (Sigma‐Aldrich; SHP001) in human embryonic kidney 293 T cells, according to the manufacturer's instructions. The WT and Tg MSCs were infected with the lentiviral particles, and stably selected by use of puromycin (10 μg/ml) as described.20 The effectiveness of SDF‐1 silencing was assessed at the protein level by ELISA (see above).
8
Lentiviral Transduction of Prostate Cancer Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
PC3, DU145 and LNCaP prostate cancer cell lines were seeded in a 96 multiwell, 35,000 cells/ well, and treated with Sh MIMIC Lenti miR-423-5p lentiviral particles (GE Healthcare Dharmacon V1SMHS_000254) at 2.5, 5, 10 and 20 MOI. Control empty backbone cells were obtained using lentiviral particles generated from the pLKO.1 Empty plasmid (MISSION® pLKO.1-puro Empty Vector Control Plasmid DNA Sigma Aldrich SHC001). Hexadimethrine Bromide (SIGMA H9268-5G) was used in complete growth media for each cell line to facilitate the infection. After 16 h incubation, infection media was removed and substituted with complete growth medium for each cell line. Puromycin (INVIVOGEN) was then added to each cell complete growth medium at a final concentration of 1 μg/ml for the selection. The lentiviral particles used to infect DU145, PC3 and LNCaP were produced according to the manufacturer’s recommendations. The lentiviral packaging mix was also purchased from Sigma (SHP001).
9
Knockdown of CAPN1 and CAPN2 in U251N Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Expression of either CAPN1 or CAPN2 was knocked down in U251N using shRNA purchased from Sigma-Aldrich (CAPN1: TRCN0000432907, TRCN0000431534; and CAPN2: TRCN0000003540, TRCN0000284853; non-target shRNA Control Plasmid: SHC016). We used a lentiviral packaging system (SHP001, Sigma-Aldrich) together with lipofectamine™ 3000 (L3000015, Invitrogen™ ThermoFisher) transfection to produce virus in HEK293 cells. Crude supernatants containing viruses were applied onto U251N cells to transduce those cells and to induce stable expression knockdowns. Expression knockdowns were verified by western blotting.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!