Since CEP120-null cells cannot survive in the presence of wild-type p53, we used CRISPR/Cas9-mediated gene targeting system30 (link) to inactivate CEP120 gene in RPE1-based p53-null cells as previously described32 (link). The targeting sequences of CEP120 gRNAs used for the CRISPR/Cas9 system were 5′-GTCGTCGTGTCCATCCTAGA-3′ and 5′-GTTTGCTACTGAGTTAGCTT-3′. We constructed the gRNA expression plasmids by inserting annealed primers into the gRNA cloning vector (plasmid #41824; Addgene). The p53-null RPE1 cells were nucleofected with 2.5 μg hCas9 plasmid (plasmid #41815; Addgene) and 2.5 μg gRNA according to the manufacturer’s instructions. Single colonies of nucleofected cells were picked and expanded by serially dilution as described32 (link). Confocal immunofluorescence microscopy, Western blotting, and DNA sequencing were used to analyze the loss of CEP120 in CEP120-null cells.
Hcas9 plasmid
Manufactured by Addgene
The HCas9 plasmid is a DNA construct that encodes the Cas9 protein, a key component of the CRISPR-Cas9 gene editing system. The Cas9 protein is responsible for recognizing and cleaving specific DNA sequences, making it a valuable tool for genetic manipulation and research.
Automatically generated - may contain errors
6 protocols using hcas9 plasmid
1
CRISPR/Cas9-mediated CEP120 knockout
2
Genome Editing in GM12878 Cells
3
Stable Seipin Variant Expression in SUM159
4
TREX1 Knockout in RPE1-hTERT and Phoenix Cells
5
Targeted Genome Editing of Duroc Pigs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To introduce an active MC1R into the Duroc genome, we devised an CRISPR/Cas9-mediated HR strategy to precisely replace the Duroc inactive MC1R allele (e) with the active MC1R allele (ED1) from Chinese indigenous black pigs, with all four missense SNP substitutions (Figure 1 B). A gRNA (GGTGTCCAGCCTCTGCTTCC with a TGG PAM site) mediating CRISPR cleavage in the SNP region was designed and ligated into U6-sgRNA cloning vector, as reported previously [21 (link)]. The homologous donor was a plasmid containing 2757 bp MC1R genome sequence of the ED1 allele covering all four SNPs with approximately 1000 bp flanking homology arms. The gRNA recognized sequence in the donor was mutated to GGTGTCCtctCTgTGtTTtCTcG (mutations are shown with lowercase letters) to avoid CRISPR cleavage at the recombinant MC1R locus. (The complete homologous donor sequence was shown in Supplemental File S1 .) For HR manipulation, MC1R donor plasmid, MC1R gRNA plasmid, and hCas9 plasmid (Addgene # 41815) were co-transfected into Duroc fetal fibroblasts to screen gene-recombinant cells.
6
Generating Stable Cell Lines
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The hCas9 plasmid, previously constructed by the Church group [21] , was obtained from Addgene (41815). Two gRNA constructs were designed following recommendations from the Church group [21] and used to generate stable cell lines expressing hrGFP and SEAP (Figure 1d). The construction of these gRNA sequences, Grik1A and Grik1B, are described in detail in Supplementary Material and Methods.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!