Lentivirus vector

The full-length coding sequence of lncRNA MDFIC-7 (lnc-MDFIC-7-wt) and its mutant (lnc-MDFIC-7-mut) were inserted into the pmirGLO empty vector to generate pmirGLO-MDFIC-7-WT and pmirGLO-MDIFC-7-mut, respectively. The ARF6 3′-UTR (3′-UTR-wt) and its mutant (3′-UTR-mut) were inserted into the pmirGLO-vector to generate pmirGLO-ARF6-3′UTR-wt and pmirGLO-ARF6-3′UTR-mut, respectively. The pGLO vector, also named pmirGLO, was obtained from Promega (Madison, WI, USA).
For knockdown of MDFIC-7, we used the following shRNA sequence: 5’- GATCCCCGAGAGAGAATTAAAGTCTATTCAAGAGATAGACTTTAATTCTCTCTCTTTTTGGAAA-3’; the control shRNA sequence was 5’- TGCTGAAATGTACTGCGCGTGGAGACGTTTTGGCCACTGACTGACGTCTCCACGCAGTACATTT-3’. The shRNAs were cloned into lentivirus vectors from Addgene (Watertown, MA, USA) to generate Lv-sh-MDFIC-7 and Lv-sh-NC.
The mock, mimic, and inhibitor for miR-525-5p were inserted into lentiviruses. We inserted the full length ARF6 (NCBI Reference Sequence: NM_001663.4) into a lentivirus vector to generate Lv-ARF6, and Lv-vector was used as a negative control.
All lentivirus constructs were synthesized and packaged by GenePharma (Shanghai, China).

The ORF of mouse JMJD3 constructed into lentivirus vector was obtained from Addgene. The ORF of mouse Hes1 was constructed into pCDH-CMV-MCS-EF1-GFP-Puro vector (System Biosciences; catalog no.: CD513B-1) by BamHI and EcoRI double enzyme digestion. The guide RNA targeting mouse JMJD3 or Hes1 was constructed into CRISPR–Caspase9 vector, respectively. The packaging vectors VSVG and Δ8.9 for lentivirus were purchased from Addgene. The primers used for vector construction and guide RNA information have been shown in Table 1.
To produce lentivirus, human embryonic kidney 293T cells were transfected with a lentiviral plasmid expressing sgRNA/complementary DNA together with the packaging plasmids VSVG and Δ8.9 using calcium phosphate transfection reagent. Lentivirus packaging with nonspecific sgRNA or empty vector was used as control. Viral supernatants were collected at 24 and 48 h after transfection, respectively. Viral supernatants were further concentrated by ∼200-fold using ultracentrifugation at 25,000 rpm for 2 h at 4 °C.

HEK293T cells were seeded in a 10 cm dish and grown in DMEM and 10% FBS medium for 24 hours or until they achieved 70% confluence. Cells were transfected with lentivirus vector (Addgene, no. 13425) encoding shRNA together with helper plasmids (Addgene; pMD2.G, no. 12259; psPAX2, no. 12260) by using polyethylenimine (PEI). At 24 hours later, medium was changed and cells were further incubated for 48 hours. After 48 hours and later every 24 hours, medium was collected and viral particles were concentrated.

Lentivirus vector was purchased from Addgene. The HSV-1 glycoprotein genes (gB ~ gN) were amplified from KOS genome and subcloned into Lentivirus vector. Lentivirus constructs with glycoprotein-expressing genes (plv-gB ~ gN) were co-transfected respectively in 293 T cells along with helper vectors using Lipofectamine 2000 according to the manufacturer’s instructions (Invitrogen). For viral transduction, the U-2 OS cells were transduced with the medium containing lentivirus harvested 48 h after transfection, in the presence of 6 μg/mL polybrene. Stable clones were selected under the pressure of puromycin.