Golden gate kit

Zebrafish were maintained under a 14 h light/10 h dark cycle at 28.5 °C and handled with care. Transcription activator-like effector nuclease (TALEN) techniques were employed to generate rrgac knock-in mutant fish as previously published [40 (link)]. Briefly, using Zifit. Available online: http://zifit.partners.org/ZiFiT/ChoiceMenu.aspx (accessed on 21 May 2021), TALEN targeting sequences were selected in the first exon of rragca gene: The TALEN left arm binding sequence, 5′- AATGGGGTTGAGGAGGA-3; right arm binding sequence 5′-CCAGAAGGTAGGAGGAA-3′. Both TALEN arms were then assembled using a Golden Gate kit (Addgene) [41 (link)]. The corresponding mRNAs were synthesized using mMESSAGE mMachine T3 (Ambion). About 25 pg capped mRNA were injected with single stranded donor DNA (ATCCTGCTAATGGGGTTGAGGAGGAGCGGGAAGTACTCTATCCAGAAGGTAGGAGGAATATGTGATATTA) into 1-cell–stage embryos of zebrafish (Danio rerio) WIK. Founder fish (F0) were raised to adulthood and outcrossed to give F1 embryos. Individual F1 embryos were used for genotyping PCR to identify knock-in mutant. Forward primer: 5′-CGGCGTATAAAGAATTGCTGG-3′, and reverse primer: 5′-GTGAAGTAGGTGAGCAAGAC-3′ were used for genotyping PCR. Resultant PCR products were digested with restriction enzyme RsaI I to determine genotype for wild type or Knock-in. The mutagenized nucleotide sequence of knock-in fish was confirmed by Sanger sequencing.

TALEN techniques were employed to generate bag3 mutants, according to our previously published approaches (Shih et al., 2016 (link)). Briefly, TALEN primer pairs targeting the 2nd exon of the bag3 gene were designed using Zifit (http://zifit.partners.org/ZiFiT/ChoiceMenu.aspx). The TALEN left-arm binding sequence 5′-TGTCATGAAAACCCTGAA-3′ and right-arm binding sequence 5′-ATCCTAGTTTCTCCTACA-3′ were used. Both TALENs were then assembled using a Golden Gate kit (Addgene) (Cermak et al., 2011 (link)). Capped mRNAs were synthesized using a mMESSAGE mMachine T3 kit (Ambion). Approximately 25 pg capped mRNA was injected into one-cell-stage embryos. Founder fish (F0) were raised to adulthood and outcrossed to generate F1 embryos. Individual F1 embryos were used for genotyping PCR to identify mutant alleles (forward primer: 5′-CGGCGTATAAAGAATTGCTGG-3′; reverse primer: 5′-GTGAAGTAGGTGAGCAAGAC-3′). The resulting PCR products were digested with the restriction enzyme PstI to identify the WT or mutant genotype. The uncut PCR products were Sanger-sequenced to determine the precise genomic lesions. Four different bag3 mutant alleles that presumably resulted in different shifts of the reading frame for each mutant locus were selected for continuous outcrosses up to the 5th generation and subsequent phenotypic analysis.