Log In Sign up
The largest database of trusted experimental protocols

Dharmofect 1

Manufactured by Horizon Discovery
Visit Supplier

DharmaFECT 1 is a cationic lipid-based transfection reagent designed for efficient delivery of small interfering RNA (siRNA) and other nucleic acids into a variety of cell types. The reagent forms complexes with nucleic acids, which are then taken up by cells, enabling effective gene silencing or other molecular manipulations.

Automatically generated - may contain errors

Lab products found in correlation

Luciferase assay kit, by Promega (2 mentions) Cel mir 67, by Horizon Discovery (2 mentions)

2 protocols using dharmofect 1

1

MiR-19 Regulation of SOCS-3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
293T cells (ATCC) were transfected with the 3'UTR SOCS-3 luciferase/RFP construct (Origene; SC215826), miR-19 mimics and scrambled controls (based on cel-miR-67, mature sequence: UCACAACCUCCUAGAAAGAGUAGA; Dharmacon), using DharmoFECT 1. Cells were analyzed 48hrs later, using the Luciferase Assay kit (Promega). Transfection efficiency was normalized to RFP signals.
Rolls A., Pang W.W., Ibarra I., Colas D., Bonnavion P., Korin B., Heller H.C., Weissman I.L, & de Lecea L. (2015). Sleep disruption impairs hematopoietic stem cell transplantation in mice. Nature communications, 6, 8516.
+ Open protocol
+ Expand
2

MiR-19 Regulation of SOCS-3 Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols
293T cells (ATCC) were transfected with the 3'UTR SOCS-3 luciferase/RFP construct (Origene; SC215826), miR-19 mimics and scrambled controls (based on cel-miR-67, mature sequence: UCACAACCUCCUAGAAAGAGUAGA; Dharmacon), using DharmoFECT 1. Cells were analyzed 48hrs later, using the Luciferase Assay kit (Promega). Transfection efficiency was normalized to RFP signals.
Rolls A., Pang W.W., Ibarra I., Colas D., Bonnavion P., Korin B., Heller H.C., Weissman I.L, & de Lecea L. (2015). Sleep disruption impairs hematopoietic stem cell transplantation in mice. Nature communications, 6, 8516.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!