RNA from cells and tissues was isolated with the miRNeasy Mini Kit (Qiagen) and miRNeasy Tissue/Cells Advanced Mini Kit (Qiagen), respectively. All of the procedures were performed according to the manufacturer’s instructions. A total of 500 ng of RNA was used for cDNA synthesis using the PrimeScript RT Master Mix (RR036A, TaKaRa). qRT-PCR was performed using the Rotor-Gene SYBR Green Master Mix (Qiagen).
Rotor gene sybr green master mix
Manufactured by Qiagen
Sourced in United States
The Rotor-Gene SYBR Green Master Mix is a ready-to-use solution for real-time PCR amplification and detection using SYBR Green I as the fluorescent dye. It contains all the necessary components for efficient and specific DNA amplification and quantification.
Automatically generated - may contain errors
Lab products found in correlation
Rotor gene q device, by Qiagen (2 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Nanodrop, by Thermo Fisher Scientific (2 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Mirneasy tissue cells advanced mini kit, by Qiagen (1 mentions)
Mirneasy mini kit, by Qiagen (1 mentions)
Superscript 3, by Thermo Fisher Scientific (1 mentions)
Dntps, by Avantor (1 mentions)
Rotor gene rg 3000, by Qiagen (1 mentions)
Nanodrop 2000 spectrophotometer, by Avantor (1 mentions)
Nucleospin rna 2 kit, by Macherey-Nagel (1 mentions)
Dnase, by Illumina (1 mentions)
Lightcycler 480 pcr machine, by Roche (1 mentions)
Protoscript m mulv first strand cdna synthesis kit, by New England Biolabs (1 mentions)
Masterpure yeast rna purification kit, by Illumina (1 mentions)
Universal probe library, by Roche (1 mentions)
Rotor gene q series software, by Qiagen (1 mentions)
Rotor gene q cycler, by Qiagen (1 mentions)
Transcriptor first strand complementary dna synthesis kit, by Roche (1 mentions)
Forward and reverse primer sequences, by Merck Group (1 mentions)
7 protocols using rotor gene sybr green master mix
1
RNA Isolation and qRT-PCR Analysis
2
RNA Isolation and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
RNA was isolated using the NucleoSpin RNA II Kit (Macherey Nagel, Düren,
Germany) according to the manufacturer’s instructions and RNA
concentration was measured using a NanoDrop 2000 spectrophotometer (Peqlab,
Erlangen, Germany). RNA was reverse transcribed into cDNA using random primers
(Roche, Mannheim, Germany), dNTPs (Peqlab) and Superscript III (Life
Technologies). qPCR (quantitative PCR) was performed in the Rotor-Gene RG3000
(Corbett Research, Sydney, Australia) using the Rotor-Gene SYBR Green Mastermix
(Qiagen, Hilden, Germany) according to the manufacturer’s instructions
and the QuantiTect primer assays Hs_QPCT_1_SG
(NM_012413) and QPCTL_1_SG (NM_017659) (Qiagen) or
specific primers for CCL2 (NM_002982.3),
ICAM1/CD54 (NM_000201.1), CX3CL1(NM_002996.3), GAPDH (NM_002046.3),
YWHAZ (NM_003406.2) all synthesized by Metabion
(Martinsried, Germany). The primer sequences are summarized in Supplementary
Table S2. Relative amounts of gene expression were determined with the
Rotor-Gene software version 6.1 using the comparative quantification method.
GAPDH and YWHAZ were used as reference
genes. Melt-curve analysis following PCR showed a single product for all the
amplicons.
Germany) according to the manufacturer’s instructions and RNA
concentration was measured using a NanoDrop 2000 spectrophotometer (Peqlab,
Erlangen, Germany). RNA was reverse transcribed into cDNA using random primers
(Roche, Mannheim, Germany), dNTPs (Peqlab) and Superscript III (Life
Technologies). qPCR (quantitative PCR) was performed in the Rotor-Gene RG3000
(Corbett Research, Sydney, Australia) using the Rotor-Gene SYBR Green Mastermix
(Qiagen, Hilden, Germany) according to the manufacturer’s instructions
and the QuantiTect primer assays Hs_QPCT_1_SG
(NM_012413) and QPCTL_1_SG (NM_017659) (Qiagen) or
specific primers for CCL2 (NM_002982.3),
ICAM1/CD54 (NM_000201.1), CX3CL1(NM_002996.3), GAPDH (NM_002046.3),
YWHAZ (NM_003406.2) all synthesized by Metabion
(Martinsried, Germany). The primer sequences are summarized in Supplementary
Table S2. Relative amounts of gene expression were determined with the
Rotor-Gene software version 6.1 using the comparative quantification method.
GAPDH and YWHAZ were used as reference
genes. Melt-curve analysis following PCR showed a single product for all the
amplicons.
3
Yeast RNA Extraction and cDNA Quantification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Strains were inoculated into YPAD and grown at 30°C for 16–18 hr. Cultures were then diluted 1:100 into YPAD and grown at 30°C for 4 hr. RNA was prepared using the MasterPure yeast RNA purification kit (Epicentre) according to the manufacturer’s instructions. RNA was treated with DNase (Epicentre) to remove contaminating genomic DNA. cDNA was prepared using the ProtoScript M-MuLV First Strand cDNA Synthesis Kit (New England Biolabs) according to the manufacturer’s instructions with oligo dT primers. cDNA was measured by qPCR using the Universal Probe Library (Roche Applied Science) with a LightCycler 480 PCR machine (Roche Applied Science) or Rotor-Gene SYBR Green master mix (Qiagen) with a Rotor-Gene cycler (Qiagen) according to the manufacturer’s instructions. Expression was calculated as the amount of cDNA from the gene of interest relative to the amount of TEF1 cDNA in the same sample using the second-derivative maximum to determine CT values and corrections for primer efficiency values.
4
Angiogenesis Gene Expression in Co-cultured DFSC/HUVEC during Osteoblast Differentiation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The expression of the angiogenesis-related genes, vascular endothelial growth factor (VEGF) and angiotensin 1 (ANG1), was analyzed by qPCR in co-cultured cells (DFSC/HUVEC ratio of 1:1) during osteoblast differentiation in osteogenic induction medium at 7, 14, and 21 days of culture. Total RNA (500 ng) was used to synthesize complementary DNA (cDNA) using HiSenScript RH(-) RT PreMix kits (iNtRON Biotechnology, Seongnam, Korea). The cDNA reaction mixture (20 μl) was incubated at 42°C for 1 hour. qPCR was performed using a Rotor-Gene Q cycler (Qiagen, CA, USA) with 50 ng of cDNA and quantified with 2× Rotor-Gene SYBR Green Master Mix (Qiagen) using specific primer sets (Table 1 ). Reactions were performed with an initial denaturation at 95°C for 10 min, followed by 40 cycles at 95°C for 10 s, 60°C for 6 s, and 72°C for 6 s. Rotor-Gene Q Series Software (Qiagen) was used to determine melting curves, amplification curves, and cycle threshold values. Gene expression levels were normalized to the corresponding control values of glyceraldehyde 3-phosphate dehydrogenase. All samples were run in triplicates and confirmed by 1.5% agarose gel electrophoresis.
5
Quantifying Gene Expression in Brain Tissue
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from snap-frozen half-brain tissues (RNeasy mini kit; Qiagen), and DNase I treatment (Roche) was used to avoid contamination from genomic DNA. One microgram of total RNA was reverse-transcribed into first-strand complementary DNA using the Transcriptor First Strand complementary DNA synthesis kit (Roche).
The forward and reverse primer sequences (Sigma-Aldrich) are reported in Supplemental Table 3. Real-time quantitative polymerase chain reaction testing was performed using the Rotor-Gene SYBR Green Master mix with the Rotor-Gene Q device (Qiagen). Relative gene expression was assessed using the ΔΔCt method, with Gapdh (Biomol Gmbh) as a housekeeping gene.
The forward and reverse primer sequences (Sigma-Aldrich) are reported in Supplemental Table 3. Real-time quantitative polymerase chain reaction testing was performed using the Rotor-Gene SYBR Green Master mix with the Rotor-Gene Q device (Qiagen). Relative gene expression was assessed using the ΔΔCt method, with Gapdh (Biomol Gmbh) as a housekeeping gene.
6
Investigating H292 Cell Response to CLE, CSE, and LPS
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
H292 cells (8 × 104 cells/well) were seeded into 12-well plates and incubated at 37 °C for 24 h. The next day, the composition of the cell culture medium was changed the FBS concentration was lowered to 0.2%, and starvation was implemented for 24 h at 37 °C. H292 cells were then co-treated with CLE (12.5, 25 μg/mL), 2% CSE, and 100 ng/mL LPS for 24 h. Total RNA was extracted from H292 cells using the QIAzol® Lysis Reagent. Extracted RNA was quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). Extracted RNA was used to synthesize cDNA at 45 °C for 1 h, followed by 95 °C for 5 min, in a C1000TM Thermal Cycler. qRT-PCR was performed using Rotor-Gene SYBR Green Master Mix (QIAGEN, Valencia, CA, USA) on a Rotor-Gene Q real-time PCR system in the presence of gene-specific primers. Information on RNA quality and quantity parameters, and primer sequences are included in the Supplementary Materials .
7
RNA Isolation and RT-qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA isolated from control and HT-fed mice half-brain were kindly provided by A. J. Kiliaan's working group. We processed the samples with DNAse I treatment (Roche, Mannheim, Germany) to avoid contaminations from genomic DNA. The isolated RNA was quantified (Nanodrop, Thermo Scientific). One µg of total RNA was reverse transcribed into first-strand cDNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche, Indianapolis, IN).
The forward (FW) and reverse (RV) primer sequences (Sigma-Aldrich) used were: tspo (FW, ggatctttccagaacatcag; RV, acgtacaaagtaggctcc), Il1b (FW, ggatgatgatgataacctgc; RV, catggagaatatcacttgttgg Arg1 (FW, ctgacctatgtgtcatttgg; RV, catctgggaactttcctttc), Gapdh (FW, ctggagaaacctgccaagta; RV, tgttgctgtagccgtattca), Tnf (FW, tgagactgagatcta, RV, ctagggtacgatcgatagc) and Cd163 (FW, agtctgctcacgatacatag, RV, tccttctggaatagattggg).
Rt-qPCR was performed using the Rotor-Gene SYBR Green master mix with the Rotor-Gene Q device (Qiagen). Relative gene expression changes were assessed using the ∆∆Ct method, with Gapdh as a housekeeping gene.
The forward (FW) and reverse (RV) primer sequences (Sigma-Aldrich) used were: tspo (FW, ggatctttccagaacatcag; RV, acgtacaaagtaggctcc), Il1b (FW, ggatgatgatgataacctgc; RV, catggagaatatcacttgttgg Arg1 (FW, ctgacctatgtgtcatttgg; RV, catctgggaactttcctttc), Gapdh (FW, ctggagaaacctgccaagta; RV, tgttgctgtagccgtattca), Tnf (FW, tgagactgagatcta, RV, ctagggtacgatcgatagc) and Cd163 (FW, agtctgctcacgatacatag, RV, tccttctggaatagattggg).
Rt-qPCR was performed using the Rotor-Gene SYBR Green master mix with the Rotor-Gene Q device (Qiagen). Relative gene expression changes were assessed using the ∆∆Ct method, with Gapdh as a housekeeping gene.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!