We first analyzed the relationship between hub TFs and various clinicopathological characteristics, and explored their expression characteristics. Then, 10 pairs of gastric cancer clinical surgical specimens were collected. All procedures were approved by the patient’s informed consent and the ethics committee of the Second Affiliated Hospital of Nanchang University. After the sample was homogenized, the total RNA was extracted with Trizol (Thermo Fisher, USA), and the RNA obtained was reverse transcribed using the reverse transcription kit RR047A (Takara, Japan). ACTB was used as the internal reference gene, and the mRNA expression of hub TFs was analyzed by rt-PCR using the RR820 kit (Takara, Japan) on the 7900-HT system (Thermo Fisher, USA). The primers were all synthesized by Shanghai Shenggong, see the attached table for details. In addition, the HPA database was used to analyze the protein expression of hub TFs [14 (link)]. Finally, the prognosis of hub TFs in GSE51105 was verified on Kaplan–Meier Plotter.
7900ht system
Manufactured by Thermo Fisher Scientific
Sourced in United States, Japan, China, United Kingdom
The 7900HT system is a real-time PCR instrument designed for DNA and RNA analysis. It is capable of performing quantitative and qualitative nucleic acid detection and analysis. The system provides accurate and reliable data for a variety of applications, including gene expression, genotyping, and viral load quantification.
Automatically generated - may contain errors
Lab products found in correlation
Trizol reagent, by Thermo Fisher Scientific (35 mentions)
Rneasy mini kit, by Qiagen (16 mentions)
Trizol, by Thermo Fisher Scientific (12 mentions)
Sybr green master mix, by Thermo Fisher Scientific (10 mentions)
Primescript rt reagent kit, by Takara Bio (8 mentions)
High capacity cdna reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
Taqman microrna reverse transcription kit, by Thermo Fisher Scientific (7 mentions)
Sds software version 2, by Thermo Fisher Scientific (6 mentions)
Sybr premix ex taq 2 kit, by Takara Bio (5 mentions)
Power sybr green pcr master mix, by Thermo Fisher Scientific (5 mentions)
Quantitect reverse transcription kit, by Qiagen (4 mentions)
Taqman human microrna array a and b, by Thermo Fisher Scientific (4 mentions)
Quantitec reverse transcription kit, by Qiagen (4 mentions)
Taqman microrna assay, by Thermo Fisher Scientific (4 mentions)
Taqman gene expression assay, by Thermo Fisher Scientific (4 mentions)
Faststart universal sybr green master mix, by Roche (4 mentions)
Iscript cdna synthesis kit, by Bio-Rad (4 mentions)
Improm 2 reverse transcription system, by Promega (4 mentions)
Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (4 mentions)
Megaplex rt primers human pool a and b, by Thermo Fisher Scientific (3 mentions)
158 protocols using 7900ht system
1
Transcription Factors in Gastric Cancer
2
Validating Hub RBPs Expression and Prognosis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
In order to verify the prognosis of hub RBPs, we used Kaplan-Meier Plotter (http://kmplot.com/ ) to verify it in the GSE29272 data set 24 (link). For the verification of hub RBPs expression, we first use the GEPIA network tool for verification, which contains data from the TCGA and GTEx databases 25 (link). In addition, we also collected surgical samples from 10 pairs of gastric cancer patients. The process was approved by the patient's informed consent and the ethics committee of the Second Affiliated Hospital of Nanchang University. After homogenizing the clinical samples, the Trizol (Thermo Fisher, USA) method was used to extract total RNA. The obtained RNA was reverse transcribed using reverse transcription kit RR047A (Takara, Japan). ACTB was used as the internal reference gene, and the mRNA expression of hub RBPs was analyzed by fluorescence quantitative PCR using the RR820 kit (Takara, Japan) on the 7900-HT system (Thermo Fisher, USA). The primers used are all synthesized by Shanghai Shenggong Company, and the sequences of all primers are in Supplementary Table 2 .
3
Quantitative PCR Analysis of MSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Culture-expanded MSCs from all tissue types were washed and lysed directly in their dishes. RNA was extracted using RNA/DNA/protein kit (Norgen Biotek, Thorold, Canada) and cDNA transcribed with High Capacity Reverse Transcription kit (ThermoFisher, Warrington, UK). Taqman assays (Supplementary Table S3 ) were run according to manufacturer’s recommendations in Format 96a Taqman low density arrays on a 7900HT system (ThermoFisher). Expression is reported relative to HPRT.
4
Comparative RNA Expression Analysis of PC
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
We analyzed the RNA expression differences of 22 genes in the Gene Expression Profiling Interactive Analysis (GEPIA) database. In addition, we collected 20 pairs of PC samples and adjacent normal samples in our hospital to analyze the RNA expression differences of these genes using RT-PCR, all of which were approved by the patient’s informed consent and the Ethics Committee of Zhejiang Provincial People’ Hospital. TRIzol (Thermo Fisher, United States) was used to extract the total RNA in the sample, and the reverse transcription kit, RR047A kit (Takara, Japan), was used to convert it into cDNA. Finally, the RR820A kit (Takara, Japan) was used to perform RT-PCR analysis on the 7900HT system (Thermo Fisher, United States), and the ACTB gene was used as the internal reference gene to calculate the expression of hub genes for each pair of tissues.
5
Quantitative PCR for Cytokine Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative polymerase chain reaction (qPCR) was performed with a 384-well plate (MicroAmp®Optical, Life Technologies Holdings Pte Ltd, Singapore) on a 7900HT system (Thermo Fisher Scientific) using the QuantiTect® Probe PCR Kit (Qiagen). The real-time reaction mixture was prepared in a total volume of 10 µL total PCR reaction and 1 µL cDNA. The cycle parameters were as follows: initial enzyme activation at 95°C for 15 minutes; followed by 40 cycles of sequential incubations at 94°C for 15 seconds and at 60°C for 1 minute; and one cycle at 40°C for 30 seconds.
Primer pairs and probes, all FAM-TAMRA labeled, were selected according to the description of Gielen et al for 18S, IFN-β, MxA, OAS, and viperin.24 (link) For IL-29, probe: 5′-AG TTGCAGCTCTCCTGTCTTCCCCG-3′, forward primer: 5′-CCTTGGAAGAGTCACTCAAGCT-3′, and reverse primer: 5′-AGAAGCCTCAGGTCCCAATT-3′ (accession number: NM_172140.1) were purchased from Eurogentec (Seraing, Belgium). For each sample, a supplementary PCR from RNA for IL-29 and IFN-β was performed to verify the absence of residual genomic DNA. Copy numbers of each gene were determined via standard curves constructed as dsDNA plasmids, and normalized with the housekeeping gene 18S rRNA.
Primer pairs and probes, all FAM-TAMRA labeled, were selected according to the description of Gielen et al for 18S, IFN-β, MxA, OAS, and viperin.24 (link) For IL-29, probe: 5′-AG TTGCAGCTCTCCTGTCTTCCCCG-3′, forward primer: 5′-CCTTGGAAGAGTCACTCAAGCT-3′, and reverse primer: 5′-AGAAGCCTCAGGTCCCAATT-3′ (accession number: NM_172140.1) were purchased from Eurogentec (Seraing, Belgium). For each sample, a supplementary PCR from RNA for IL-29 and IFN-β was performed to verify the absence of residual genomic DNA. Copy numbers of each gene were determined via standard curves constructed as dsDNA plasmids, and normalized with the housekeeping gene 18S rRNA.
6
Quantitative PCR Analysis of Metabolic Genes
7
Differential Expression Analysis of Prostate Cancer Genes
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To visualize the differences in clinical expression of key gene proteins, we investigated the expression of these genes in PC tissue and normal tissue in the Human Protein Atlas (HPA) database. Furthermore, to verify the expression levels of 14 mRNAs, we performed differential gene expression analysis on tumor tissues and normal tissues in TCGA-PRAD. In addition, we collected 20 pairs of PC samples and adjacent normal samples in our hospital to analyze the RNA expression differences of these genes using rt-PCR, all of which were approved by the patients’ informed consent and the ethics committee of Zhejiang Provincial People’s Hospital. TRIzol (Thermo Fisher, USA) was used to extract the total RNA in the sample, and the “Reverse Transcription RR047A Kit (Takara, Japan) was used to convert it into cDNA. Finally, the RR820A kit (Takara, Japan) was used to perform rt-PCR analysis on the 7900HT system (Thermo Fisher, USA), and the ACTB gene was used as the internal reference gene to calculate the expression of hub genes with each pair of tissues.
8
Quantifying Autophagy Genes in LT-HSCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
LT-HSCs were lysed after 5 days culture in lysis buffer from ZR RNA MicroPrep (Zymo Research) and RNA extraction was performed accordingly to the manufacturer's instruction. RNA was eluted and resuspended in 6 μl of H2O. Four microlitres of RNA was retro-transcribed to cDNA with Vilo SScript system (Invitrogen). Subsequently cDNA was diluted five times in water. For QPCR 1.5 μl of cDNA, 5 μl of Power Syber Green mastermix (Applied Biosystem) and 200 nM of primers were added to a final volume of 10 μl for each reaction. The reactions were performed on 7900HT system (Applied Biosystem). Primer sequences (5′-3′) are the following: LC3-F GTCACCCAGGCGAGTTACC; LC3-R TTACAGCGGTCGGCGAAG; Sqstm1-F GCTGAAGGAAGCTGCCCTAT; Sqstm1-R TTGGTCTGTAGGAGCCTGGT; Park2-F CCGAATCACCTGACGGTTCA; Park2-R TCTGGCTGCTTCTGAATCCC; Arbp-F AGATTCGGGATATGCTGTTGG; Arbp-R AAAGCCTGGAAGAAGGAGGTC.
9
Quantifying Gene Expression by qPCR
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was isolated from cell pellets using RNeasy Plus Mini Kit (QIAGEN) following the manufacturer’s instructions and reverse-transcribed into cDNA with SuperScript IV First-Strand Synthesis System (Thermo Fisher Scientific). Quantitative real-time PCR analysis was performed with TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) in a 7900 HT System (Applied Biosystem). TaqMan primers targeting HHLA2 (Hs00737670_m1), TMIGD2 (Hs00758270_m1), GAPDH (Hs03929097_g1), and GUSB (Hs00939627_m1) were purchased from Thermo Fisher Scientific. Target gene expression were quantitated utilizing the comparative CT (ddCT) method and normalized against the housekeeping genes GAPDH and GUSB.
10
RNA Extraction and qPCR Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from GC tissues or cancer cells using TRIzol reagent (Invitrogen) according to the manufacturer’s instructions. First-strand complementary DNA (cDNA) was synthesised using HiscriptQ RT SuperMix for quantitative PCR (qPCR) (Vazyme, Nanjing, China) on a 7900HT system (Applied Biosystem, Waltham, MA, USA). The PCR primers used to amplify target genes are shown in Supplementary Table S3 . The results were normalised to the expression of β-actin, and the relative levels of messenger RNA (mRNA) were analysed by the 2−△△CT method; each sample was analysed in triplicate.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!