Fastquant cdna rt kit

Total RNA was purified using the RNA Prep Pure Cell Kit according to the manufacturer’s instructions (Tiangen Biotech, China). Then, cDNAs were synthesized using the Fast Quant cDNA RT Kit and mRNA expression was measured using the SYBR Green Quant qRT-PCR Kit (all from Tiangen Biotech, China). The 2^−ΔΔCt method was used to normalize transcription to β-actin and to calculate the fold-induction relative to the control. The primer pairs were used: Mus β-actin, forward GAGACCTTCAACACCCCAGC, reverse ATGTCACGCACGATTTCCC; Mus Bcl-6, forward CCTGAGGGAAGGCAATATCA, reverse CGGCTGTTCAGGAACTCTTC; Mus STAT3, forward CCGTCTGGAAAACTGGATAACT, reverse CCCTTGTAGGACACTTTCTGCT; and Mus Foxp3, forward CCCAGGAAAGACAGCAACCTT, reverse TTCCACAACAAGGCCACTTG.

Total RNA was isolated from cotton plants that were infected with Vd991 or exposed to 100 μM MeJA using an RNA extraction kit (Biomed, Enzo Life Sciences, Exeter, United Kingdom). The first strand of cDNA was synthesized from 2 μg of total RNA with a FASTQuant cDNA RT Kit (TIANGEN Biotech Co., Ltd) and used as template in quantitative reverse transcription polymerase chain reaction (qRT-PCR). The cotton GhUBQ gene was used as an internal control. Primers were designed as shown in Supplementary Table S1. Reactions were prepared in 20-μL tubes using SYBR^®-Premix Ex Taq (Tli RNaseH Plus; Takara, Shiga, Japan) and amplified on an ABI 7500 thermocycler (Applied Biosystems, Foster City, CA, United States). Expression was determined by the 2^-ΔΔCT method, and data were analyzed in Origin 8 (Liu et al., 2017 (link)).

Total RNAs were isolated from plant tissues with Trizol (TIANGEN Biotech, Beijing, China) following the manufacturer’s instructions. RNA quality was determined by a Nanophotomoter (Implen, München, Germany). The removal of genomic DNA residues, reverse transcription and cDNA synthesis were separately performed with 2 μg of total RNA and a FastQuant cDNA RT Kit (TIANGEN Biotech). Real-time PCR analysis of GmCYP78As was performed with the FastStart Essential DNA Green Master (Roche, Shanghai, China) on a Stratagene Mx3005P (Agilent Technologies, Santa Clara, CA, USA, Supplementary Table S1). The relative expression levels were calculated from three replicates using the 2^−ΔΔCt method after normalization to the Actin11 control in soybean [31 (link)].