Log In Sign up
The largest database of trusted experimental protocols

Afkjs 9

Manufactured by Thermo Fisher Scientific
Visit Supplier

The AFKJS-9 is a laboratory instrument designed for sample preparation and analysis. It is a compact and versatile device that can perform various functions such as mixing, stirring, and heating. The AFKJS-9 is suitable for use in a wide range of applications, including research, quality control, and product development in various industries.

Automatically generated - may contain errors

Lab products found in correlation

Fjk 16, by Thermo Fisher Scientific (3 mentions) Monensin, by Merck Group (2 mentions) Ebio4b10, by Thermo Fisher Scientific (2 mentions) Ionomycin, by Merck Group (2 mentions) Facsdiva software, by BD (2 mentions) Facscanto 2, by BD (2 mentions) Live dead fixable aqua dead cell stain kit, by Thermo Fisher Scientific (1 mentions) Anti cd3 apccy7, by Thermo Fisher Scientific (1 mentions) Cytofix cytoperm, by BD (1 mentions) Ebio64dec17, by Thermo Fisher Scientific (1 mentions) 22urti, by Thermo Fisher Scientific (1 mentions) Anti foxp3 e450, by Thermo Fisher Scientific (1 mentions) Golgiplug, by BD (1 mentions) Ebr2a, by Thermo Fisher Scientific (1 mentions) Tc11 18h10, by BioLegend (1 mentions) Q31 378, by BD (1 mentions) Anti cd3 17a2, by BioLegend (1 mentions) Cd4 gk1, by BioLegend (1 mentions) Mp1 22e9, by BD (1 mentions) Cd8 53 6, by BioLegend (1 mentions)

12 protocols using afkjs 9

1

Immunohistochemical Analysis of ROR-γ in Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
IHC was performed as previously described51 ,57 with the following modifications. Antigen retrival for sections of tissue microarrays (TMA PR803b from Biomax.US) was performed in a pressure cooker. The slides were then incubated with anti-ROR-γ monoclonal antibody (AFKJS-9, eBioscience) at 1:50 dilutions overnight at 4°C, followed by incubations with biotinylated secondary antibody and the ABC reagents in the Vectastain Elite kit and counter-stained with hematoxylin. The TMA contained specimens from 70 cases of prostate cancer with information provided for most of the cases on stage, Gleason scores and TNM grading. The percentage of positive nuclear staining was scored as follows: 0% – <5%, score 0; 5% – <10%, score 1; 10% – 50%, score 2; >50%, score 3. Differences and correlations in immunostaining among groups were analyzed with the χ2 test.
Wang J., Zou J.X., Xue X., Cai D., Zhang Y., Duan Z., Xiang Q., Yang J.C., Louie M.C., Borowsky A.D., Gao A.C., Evans C.P., Lam K.S., Xu J., Kung H.J., Evans R.M., Xu Y, & Chen H.W. (2016). ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer. Nature medicine, 22(5), 488-496.
+ Open protocol
+ Expand
2

Isolation and Analysis of Colonic Immune Cells

Cited 1 time
Check if the same lab product or an alternative is used in the 5 most similar protocols
Lamina propria mononuclear cells were isolated from colonic tissue as previously described (7 (link)). LIVE/DEAD fixable aqua dead cell stain kit (Molecular Probes) was used to exclude dead cells. For cytokine detection, cells were stimulated with phorbol myristate acetate (PMA) and ionomycin with BD GolgiPlug for 4 hours. Following surface-marker staining with anti-CD3-APCCy7 (eBiosciences UCHT1) and anti-CD4-BUV650 (BioLegend OKT4), cells were prepared as per manufacturer’s instruction with Cytoperm/Cytofix (BD Biosciences) for intracellular cytokine evaluation of IL-17A (eBiosciences eBio64DEC17), IL-4 (eBiosciences 8D4-8), IL-22 (eBiosciences 22URTI) and IFNγ (eBiosciences 4S.B3). For transcription factor analysis, cells were fixed and permeabilized as per manufacturer’s instructions (eBiosciences) and stained intracellularly with anti-Foxp3-E450 (eBiosciences 236A/E7) and anti-RORγt-PE (eBiosciences AFKJS-9). Data acquisition was computed with BD LSRFortessa flow cytometers and analysis performed with FlowJo software.
Jacob V., Crawford C., Cohen-Mekelburg S., Viladomiu M., Putzel G.G., Schneider Y., Chabouni F., O’Neil S., Bosworth B., Woo V., Ajami N.J., Petrosino J.F., Kassam Z., Smith M., Iliev I., Sonnenberg G.F., Artis D., Scherl E, & Longman R. (2017). Single Delivery of High-diversity Fecal Microbiota Preparation by Colonoscopy is Safe and Effective in Increasing Microbial Diversity in Active Ulcerative Colitis. Inflammatory bowel diseases, 23(6), 903-911.
+ Open protocol
+ Expand
3

Immunohistochemical Analysis of ROR-γ in Prostate Cancer

Check if the same lab product or an alternative is used in the 5 most similar protocols
IHC was performed as previously described51 ,57 with the following modifications. Antigen retrival for sections of tissue microarrays (TMA PR803b from Biomax.US) was performed in a pressure cooker. The slides were then incubated with anti-ROR-γ monoclonal antibody (AFKJS-9, eBioscience) at 1:50 dilutions overnight at 4°C, followed by incubations with biotinylated secondary antibody and the ABC reagents in the Vectastain Elite kit and counter-stained with hematoxylin. The TMA contained specimens from 70 cases of prostate cancer with information provided for most of the cases on stage, Gleason scores and TNM grading. The percentage of positive nuclear staining was scored as follows: 0% – <5%, score 0; 5% – <10%, score 1; 10% – 50%, score 2; >50%, score 3. Differences and correlations in immunostaining among groups were analyzed with the χ2 test.
Wang J., Zou J.X., Xue X., Cai D., Zhang Y., Duan Z., Xiang Q., Yang J.C., Louie M.C., Borowsky A.D., Gao A.C., Evans C.P., Lam K.S., Xu J., Kung H.J., Evans R.M., Xu Y, & Chen H.W. (2016). ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer. Nature medicine, 22(5), 488-496.
+ Open protocol
+ Expand
4

Intracellular Cytokine Staining and mTOR/STAT3 Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols
For intracellular staining of IL-10, IL-17 and IFN-γ, cells were stained first for surface antigens with antibodies (e.g. RM4-5 for CD4 or 53-6.7 for CD8) and then activated in RPMI 1640 (10% FBS) with PMA (50 ng/ml), ionomycin (1 μM), and monensin (2 mM; Sigma-Aldrich) for 4 h. Cells were then fixed, permeabilized, and stained with antibodies to mIL-10 (JES5-16E3), mIL-17A (TC11-18H10.1) or IFN-γ (XMG1.2). Cells were stained with an antibody to mouse FoxP3 (FJK-16s), T-bet (eBio4B10), or RORγt (AFKJS-9) according to the manufacturer’s protocol (eBioscience). For co-staining of IL-10 and FoxP3, the cells prestained with anti-CD4 (RM4-5) were activated with PMA (50 ng/ml), ionomycin (1 μM), and Brefeldin A (25 μg/ml) for 4 h. Activated cells were fixed, permeabilized, and stained with antibodies to IL-10 and FoxP3.
For assessment of mTOR activation or STAT3 activation, mouse CD4+ cells were activated for up to 60 hours in complete RPMI-1640 medium with an immobilized antibody to CD3 (5 μg/ml) and soluble antibody to CD28 (2 μg/ml) in the presence of C2 (0, 1, 10, or 20 mM), C3 (0, 0.1, 0.5, or 1 mM) or C4 (0, 0.125, 0.25, or 0.5 mM). Antibodies to phosphorylated rS6 (Ser235/236; D57.2.2E), phosphorylated STAT3 (Y705; D3A7), phosphorylated MAPK (Erk1/2) (Thr202/Tyr204; 137F5) were used for flow cytometry (all from Cell Signaling Technology, Danvers, MA).
Park J., Kim M., Kang S.G., Jannasch A.H., Cooper B., Patterson J, & Kim C.H. (2014). Short chain fatty acids induce both effector and regulatory T cells by suppression of histone deacetylases and regulation of the mTOR-S6K pathway. Mucosal immunology, 8(1), 80-93.
+ Open protocol
+ Expand
5

Intracellular Cytokine Staining and mTOR/STAT3 Activation

Check if the same lab product or an alternative is used in the 5 most similar protocols
For intracellular staining of IL-10, IL-17 and IFN-γ, cells were stained first for surface antigens with antibodies (e.g. RM4-5 for CD4 or 53-6.7 for CD8) and then activated in RPMI 1640 (10% FBS) with PMA (50 ng/ml), ionomycin (1 μM), and monensin (2 mM; Sigma-Aldrich) for 4 h. Cells were then fixed, permeabilized, and stained with antibodies to mIL-10 (JES5-16E3), mIL-17A (TC11-18H10.1) or IFN-γ (XMG1.2). Cells were stained with an antibody to mouse FoxP3 (FJK-16s), T-bet (eBio4B10), or RORγt (AFKJS-9) according to the manufacturer’s protocol (eBioscience). For co-staining of IL-10 and FoxP3, the cells prestained with anti-CD4 (RM4-5) were activated with PMA (50 ng/ml), ionomycin (1 μM), and Brefeldin A (25 μg/ml) for 4 h. Activated cells were fixed, permeabilized, and stained with antibodies to IL-10 and FoxP3.
For assessment of mTOR activation or STAT3 activation, mouse CD4+ cells were activated for up to 60 hours in complete RPMI-1640 medium with an immobilized antibody to CD3 (5 μg/ml) and soluble antibody to CD28 (2 μg/ml) in the presence of C2 (0, 1, 10, or 20 mM), C3 (0, 0.1, 0.5, or 1 mM) or C4 (0, 0.125, 0.25, or 0.5 mM). Antibodies to phosphorylated rS6 (Ser235/236; D57.2.2E), phosphorylated STAT3 (Y705; D3A7), phosphorylated MAPK (Erk1/2) (Thr202/Tyr204; 137F5) were used for flow cytometry (all from Cell Signaling Technology, Danvers, MA).
Park J., Kim M., Kang S.G., Jannasch A.H., Cooper B., Patterson J, & Kim C.H. (2014). Short chain fatty acids induce both effector and regulatory T cells by suppression of histone deacetylases and regulation of the mTOR-S6K pathway. Mucosal immunology, 8(1), 80-93.
+ Open protocol
+ Expand
6

Quantifying RORγt Occupancy in Th17 Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
Freshly isolated naive CD4+ T cells from wild-type mice were cultured under Th17- polarizing conditions, with or without ITA treatment. After 2 days, 4.5 × 106 cells were harvested, and ChIP was performed using the ChIP system (Thermo Fisher Scientific) according to the manufacturer’s instructions. The soluble chromatin supernatant was immunoprecipitated with an anti-RORγt antibody (40 μg mL−1, clone AFKJS-9, eBioscience, 14-6988-82) and IgG control (40 μg mL−1, clone eBR2a, eBioscience, 14-4321-82). Immunoprecipitated DNA and input DNA were measured by qPCR using a SYBR green reagent. Data were expressed as the percent input for each ChIP fraction. The primers used for amplification of the promoter of Il17a containing the RORγt-binding site were 5′ CAGCTCCCAAGAAGTCATGC 3′ (forward) and 5′ GCAACATCTGTCTCGAAGGTAG 3′ (reverse)47 (link).
Aso K., Kono M., Kanda M., Kudo Y., Sakiyama K., Hisada R., Karino K., Ueda Y., Nakazawa D., Fujieda Y., Kato M., Amengual O, & Atsumi T. (2023). Itaconate ameliorates autoimmunity by modulating T cell imbalance via metabolic and epigenetic reprogramming. Nature Communications, 14, 984.
+ Open protocol
+ Expand
7

Antibody Panel for T-cell Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
The following antibodies were used for flow cytometry analysis and fluorescence-activated cell sorting (FACS): Anti-CD3 (17A2, Biolegend, 1:400), anti-CD4 (GK1.5, Biolegend, 1:100 or 1:400), anti-CD8 (53–6.7, Biolegend, 1:400), anti-CD25 (PC61, Biolegend, 1:400), anti-CD44 (IM7, Biolegend, 1:400), anti-CD62L (MEL-14, Biolegend, 1:400), anti-IL-17A (TC11-18H10.1, Biolegend, 1:100), anti-IFN-γ (XMG1.2, Biolegend, 1:100), anti-GM-CSF (MP1-22E9, BD, 1:100), anti-RORγt (Q31-378, BD, 1:50), anti-Foxp3 (150D, Biolegend, 1:50), anti-T-bet (4B10, Biolegend, 1:50) and anti-TCRVβ8.1/8.2 (KJ16-133.18, Biolegend, 1:20). For immunoblot analyses, anti-JunB (C37F9, Cell Signaling Technology, 1:2,000), anti-RORγt (AFKJS-9, eBioscience, 1:400) and anti-GAPDH (3H12, MBL, 1:2,000) were used. For ChIP analyses, anti-JunB (210, Santa Cruz, 2 μg per ChIP), anti-BATF (WW8, Santa Cruz, 2 μg per ChIP), anti-IRF4 (M-17, Santa Cruz, 2 μg per ChIP), anti-STAT3 (c-20, Santa Cruz, 2 μg per ChIP) were used.
Hasan Z., Koizumi S.I., Sasaki D., Yamada H., Arakaki N., Fujihara Y., Okitsu S., Shirahata H, & Ishikawa H. (2017). JunB is essential for IL-23-dependent pathogenicity of Th17 cells. Nature Communications, 8, 15628.
+ Open protocol
+ Expand
8

Multiparameter Flow Cytometry Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Antibodies against CD3e (145-2C11), CD4 (GK1.5), NK1.1 (PK136), CD19 (eBio1D3), CD24 (30-F1), CD44 (IM7), CD45.1 (A20), CD45.2 (104), CD48 (HM48-1), CXCR5 (SPRCL5), GL7 (GL-7), GATA3 (TWAJ), IgD (11-26C), ICOS (7E.17G9), Ly9 (Ly9ab3), PD1 (J43), PLZF (Mags.21F7), RORγt (AFKJS-9), 2B4 (eBio244F4), 7-AAD, and streptavidin were purchased from eBioscience. Antibodies against CD138 (281–2) and Fas (Jo2) were purchased from BD. Antibodies against SLAM (12F12), CD84 (CD84.7), and Ly-108 (330-AJ) were purchased from BioLegend, whereas CRACC antibody (clone 520914) was provided by R&D Systems. Antibodies against Egr2 were purchased from Abcam, and goat anti–rabbit IgG (H+L) was purchased from Thermo Fisher Scientific. CD1d-tetramer (19156, loaded with PBS57) and empty CD1d control were kindly provided by the National Institutes of Health Tetramer Core Facility.
Chen S., Cai C., Li Z., Liu G., Wang Y., Blonska M., Li D., Du J., Lin X., Yang M, & Dong Z. (2017). Dissection of SAP-dependent and SAP-independent SLAM family signaling in NKT cell development and humoral immunity. The Journal of Experimental Medicine, 214(2), 475-489.
+ Open protocol
+ Expand
9

Phenotyping Th Cell Subsets in Autoimmune Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols
Joint draining LN cells from 6 week old KRN.g7 and IDO2 ko KRN.g7 mice were harvested and stained for CD4+ T cells (BioLegend clone GK1.5) and the following markers to distinguish Th subsets: bcl6 (Tfh, BD Pharmingen Clone K112g1), foxP3 (Treg, Biolegend clone 150D), gata3 (Th2, eBioscience clone TWAJ), rorγt (Th17, eBioscience clone AFKJS-9), T-bet (Th1, eBioscience clone 4B10). The samples were acquired on a BDFACSCanto II flow cytometer using FACSDiva Software (BD Bioscience) and analyzed using FlowJo Software (TreeStar).
Merlo L.M., Pigott E., DuHadaway J.B., Grabler S., Metz R., Prendergast G.C, & Mandik-Nayak L. (2014). IDO2 is a critical mediator of autoantibody production and inflammatory pathogenesis in a mouse model of autoimmune arthritis. Journal of immunology (Baltimore, Md. : 1950), 192(5), 2082-2090.
+ Open protocol
+ Expand
10

Flow Cytometric Analysis of T Cell Subsets

Check if the same lab product or an alternative is used in the 5 most similar protocols
Flow cytometric analysis was performed on all PBMCs to detect nTregs (CD4+CD25+Foxp3+), iTregs (CD4+CD25−Foxp3+) and Th17 (CD4+CD25−RORγt) cells by utilizing the protocol from Braundmeier et al. 2012. Briefly, approximately 105 to 106 mononuclear cells were stained directly with anti-human FITC-CD4 (L200; 550628, BD Pharmigen), anti-human APC-CD25 (BC96; 17-0259, eBioscience), anti-human PE-Foxp3 (PCH101; 12-4776; eBioscience) and anti-human PE-RORγt (AFKJS-9; 12-6988; eBioscience) antibodies. Lymphocyte cell populations were sorted using a BD Accuri C6 flow cytometer and its respective software (BD Biosciences). Populations were gated on CD4 fluorescent intensity; CD4+ subpopulations were identified by CD25+, Foxp3+ and RORγt+ fluorescent intensity. Treg and Th17 cells were compared within each animal.
Le N., Cregger M., Fazleabas A, & Braundmeier-Fleming A. (2022). Effects of endometriosis on immunity and mucosal microbial community dynamics in female olive baboons. Scientific Reports, 12, 1590.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!