Ab203953

A ChIP-seq experiment was performed to determine the protein binding on CHK1 promoter. After knocking down FLT3-ITD in MV4-11 cells, the cells were collected and prepared for cross-linked chromatin. A Bioruptor UCD-200 ultrasound system (Diagenode) was used to break the chromatin into fragments of about 200 bp in size. The fragments were incubated with specific antibodies (anti-CBP (ab 119,488, Abcam), anti-p300 (ab14984, Abcam), anti-H3K9ac (ab272150, Abcam), anti-H3K27ac (ab203953, Abcam) at 4 degrees overnight. Rabbit serum was used as a control. High-Sensitivity ChIP Kit (ab185913, Abcam) was used for RNA elution and purification according to the manufacturer's instructions. QPCR was used to detect the degree of enrichment of the CHK1 promoter sequence.

Chromatin immunoprecipitation (ChIP) assay was performed using the EZ‐Magna ChIP kit (EMD Millipore). According to the manufacturer's procedure, NK cells were crosslinked with 4% paraformaldehyde (PFA) for 10 minutes and quenched with glycine. Next, cells were lysed with cell lysis buffer and nuclear lysis buffer and subjected to sonication to fragment chromatin to 200‐300 bp. Sonicated chromatin was then immunoprecipitated with magnetic protein A beads bound with antibodies, namely 2 μg negative control IgG (ab171870; Abcam), or 2 μg H3K27ac (ab203953; Abcam), 2 μg P300 (ab14984; Abcam), 2 μg H3K4me1 (ab8895; Abcam), and 2 μg CDX2 (sc‐134362; Santa Cruz Biotechnology Inc.). Finally, RT‐qPCR was applied to analyse the enrichment of proteins on the enhancer region of CXCL14 (chr5:134906373‐134914969). Primers used for qPCR included forward (5′‐3′): CACCTGCGAAGGAAGGAGTT and reverse (5′‐3′): TGAGGACTTCAGTGGGGTGA.

Cells were fixed using 1% formaldehyde and harvested on ice with ChIP lysis buffer (50 mM Tris-HCl pH 8.0, 5 mM ethylenediaminetetraacetic acid (EDTA), 0.1% deoxycholate, 1% Triton X-100, 150 mM NaCl, and proteinase inhibitors). Total extracted chromatin was sonicated to an average size of 250–500 bp using an immersion sonicator. Chromatin extracts were diluted with immunoprecipitation (IP) buffer (1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl of pH 8.1, 150 mM NaCl, supplemented with complete protease inhibitors) and incubated overnight with the anti-histone H3 (acetyl K27) antibody (ab203953, Abcam) or IgG at 4 °C on a rotating platform. Protein A and G sepharose-beads (GE Healthcare Life Sciences) were pre-coated with IP buffer supplemented with 5% bovine serum albumin to reduce nonspecific antibody binding. After incubation of protein A or G sepharose beads for 2 h, beads were washed sequentially for 5 min on a rotating platform. Finally, the DNA fraction in the DCTPP1 gene promoter was analyzed using qPCR. DNA enrichment was normalized to input samples (1% of total chromatin used per IP) and expressed as fold enrichment of specific binding over the control nonspecific IgG binding.