Trizol solution

Total RNA was extracted from stomach tissues or cultured cells using Trizol solution (TAKARA, Japan). An amount of 2 μg of total RNA was used for the reverse transcription reaction with RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Waltham, MA, USA). Real-time qPCR was carried out in 20 µL final volume using 1 ng/µL cDNA and forward and reverse primers (500 nM each) using TB Green Premix Ex Taq II (TAKARA, Asazu City, Japan) in CFX Connect PCR System (Bio-Rad, Hercules, CA, USA). The primer sequences are shown in Table S1.

TRIzol solution (TaKaRa, Japan) was performed to isolate RNA from pancreatic carcinoma samples. Then, cDNA was formed with a reverse transcription kit following the supplier’s specification. Then, the ABI Prism 7700 sequence detection system was applied to perform the qRT-PCR process with the subsequent steps: 95° C for 5 min, 40 cycles of 95° C for 30 s, 60° C for 45 s, and 72° C for 90 s and 72° C for 10 min. The relative expression of HCG11, miR-579-3p and MDM2 were analyzed by 2^-ΔΔCT method. GAPDH was deemed as the standard control for detection of HCG11 and MDM2. U6 was deemed as the standard control for determination of miR-579-3p. The primers were listed as below:
HCG11, F: 5’-AATGGTGGTAGGAGGGAGGA-3’,
R: 5’-CACACAGGGGAATGAAGAGG-3’;
MiR-579-3p, F: 5’-GCACGGAACTTCCCTTGACGTC-3’,
R: 5’-GCTCTAGGGATCGTCGCCGAA-3’;
MDM2, F: 5’-ATGTGCAATACCAACATCTCTGTGTC-3’,
R: 5’-GCTGACTTACAGCCACTAAATTTC-3’;
GAPDH, F: 5’-CGGAGTCAACGGATTTGGTCGTAT-3’,
R: 5’-AGCCTTCTCCATGGTGGTGAAGAC-3’;
U6, F: 5’-CGCTTCGGCAGCACATATACTAA-3’,
R: 5’-TATGGAACGCTTCACGAATTTGC-3’.

Total RNA from the intestinal mucosa was extracted using Trizol solution (Takara, Japan). The expression of cytokine genes was assayed using reverse-transcriptase polymerase chain reaction (RT-PCR). The β-actin (Actb) mRNA level was used as an internal reference, and levels of mRNA expression were quantitated by optical densitometry after electrophoresis on an agarose gel. All primers are listed in Table 1. The reverse transcription was conducted at 37°C for 15 min, 95°C 5 sec. The PCR cycling condition was 36 cycles at 94°C for 40 sec, 55°C (Il10 and Il1b), 57°C (Il17 and Ifng) or 59°C (Actb) for 30 sec and 72°C for 35 sec. The PCR end products were run on a 5% agarose gel and stained with ethidium bromide. The gray values of the bands were calculated using quantity one software (Bio-Rad, America). The relative mRNA expression levels of the target genes were normalized to the corresponding internal standard.Table 1

RT-PCR primer sequences

Cytokines	Primer sequence
Il1b (94 bp)	Forward 5′—ATGGGCAACCACTTACCTATTT—3′
	Reverse 5′—GTTCTAGAGAGTGCTGCCTAATG—3′
Il10 (116 bp)	Forward 5′—ACAGCCGGGAAGACAATAAC—3′
	Reverse 5′—CAGCTGGTCCTTTGTTTGAAAG—3′
Il17 (123 bp)	Forward 5′—CGCAATGAAGACCCTGATAGAT—3′
	Reverse 5′—CTCTTGCTGGATGAGAACAGAA—3′
Ifng (128 bp)	Forward 5′—AAATCCTGCAGAGCCAGATTAT—3′
	Reverse 5′—GCTGTTGCTGAAGAAGGTAGTA—3′
Actb (470 bp)	Forward 5′—AGGCTGTGCTGTCCCTGTATG—3′
	Reverse 5′—GAGGTCTTTACGGATGTCAACG—3′

Total RNA was extracted by using TRIzol solution (TaKaRa, 9109) according to the manufacturer’s instructions. Then, the RNA was reverse transcribed into cDNA on a PCR amplifier by using a PrimeScript RT Reagent Kit (TaKaRa, RR037A). Then, qPCR was performed by using TB Green Premix Ex Taq II (TaKaRa, RR820A) according to the manufacturer’s directions, and gene expression was measured by using a real-time fluorescence quantitative PCR system (Applied Biosystems, 7500). GAPDH served as the reference gene, and the relative gene expression was determined with the 2^−ΔΔCt method. The relevant primers are listed in Supplementary Table 1.

Total RNA was extracted from plant samples using Trizol solution (TaKaRa, Japan), and first-strand cDNA was reverse-transcribed using the PrimeScript 1st Strand cDNA Synthesis Kit (TaKaRa, Japan). qRT–PCR analysis was conducted with an ABI prism 7500 Real-Time PCR system (Applied Biosystem, Life Technologies, Carlsbad, CA, USA) using Top Green qPCR SuperMix (+ Dye I) kit (TransGen, Beijing, China). PCR was performed after a preincubation at 94 °C for 30 s and was followed by 40 cycles of amplification (94 °C for 5 s, 58 °C for 15 s, and 72 °C for 32 s). Each sample with four biological replicates was quantified using the 2^−ΔΔCt method according to the cycle threshold (Ct) values [64 (link)]. The transcript level of the soybean tubulin gene (Glyma.03g124400) was used as an internal control. All primer sequences were designed using Primer Premier 5.0 software and are detailed in Table S1.

The mRNA expression of hypocretin was estimated using real-time RT-PCR according to the method described previously [39 (link)]. Trizol solution (TaKaRa, Aichi Ken, Japan) was used to isolate total RNA from samples. Then, using a reverse transcription kit, 1.0 μg of total RNA was transcribed into cDNA according to the supplier’s instructions. RT-PCR analysis was carried out using SYBR^® Green PCR Master Mix (Invitrogen, Warrington, UK). The β-actin gene was used as an endogenous control for the normalization of the sample. The primers used for OX₁R were as follows: forward 5′-CCTGGCTGAAGTGAAGCAGA-3′ and reverse 5′-CTGATGGGCAGGTAGCAGAG-3′; OX₂R, forward 5′-forward 5′-TCGCAACTGGTCATCTGCTT-3′ and reverse 5′-CTCGTCGTCATAGTCGGTGG-3′; β-actin, forward 5′-ATCTGGCACCACACCTTCTACAATGAGCTGCG-3′ and reverse 5′-CGTCATACTCCTGCTTGCTGATCCACATCTGC-3′; PLC, forward 5′-TCGTCCCACAACGAGCA-3′ and reverse 5′-TCGTCCCACAACGAGCA-3′.