Lightcycler 480 pcr instrument

The renal cancer cell lines (786-O, 769-P, ACHN, Caki-1, Caki-2) and human renal tubular epithelial cell line (HK-2) were purchased from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI 1640 (786-O, 769-P); McCoy’s 5A (Caki-1, Caki-2); DMEM (ACHN) and DMEM/F12 (HK-2) (Gibco, Thermo Fisher Scientific, USA) containing 10% fetal bovine serum and 1% penicillin/streptomycin (Gibco, Thermo Fisher Scientific, USA). PFK15 (PFK-015; Selleck, China), 2-Deoxy-d-glucose (2-DG; Selleck, China), Sunitinib (SU11248) malate (Sunitinib; Selleck, China), and dimethylsulfoxide (DMSO; Sigma–Aldrich, USA) were also used. Cells were transfected with control siRNA and siRNA-PFKFB3 using Lipofectamine 3000 (Invitrogen, Thermo Fisher Scientific, USA). QRT-PCR and Western blot assays were used to evaluate the efficiency of siRNA interference. Total RNA was isolated using Trizol (Invitrogen, Thermo Fisher Scientific, USA). HiScript III All-in-one RT SuperMix (Vazyme, China) was used for cDNA synthesis. qRT-PCR was performed with SYBR qPCR Master Mix (Vazyme, China) using StepOne Plus (Applied Biosystems, USA) and LightCycler 480 PCR instrument (Roche Diagnostics, Switzerland) according to the manufacturer’s instructions. The primers and siRNA Oligo used are listed in Additional file 1: Table S1.

Total RNA was extracted from the uteri and marrow derived dendritic cells (BMDCs) with Trizol^® reagent (Invitrogen, Carlsbad, CA) and was reverse transcribed into stable cDNA using M‐MLV reverse transcriptase buffer (Invitrogen, Carlsbad, CA) in accordance with the manufacturer's instructions. The amplification of cDNA was performed using 2× UltraSYBR Mixture (CWBIO, Co. Ltd, Beijing, China). Real‐time quantitative PCR was carried out with a LightCycler 480 PCR instrument (Roche, Indianapolis, IN). The target gene mRNA expression was normalized to glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) expression. The fold change was calculated as 2^−ΔΔCt (cycle threshold). The primers used for quantitative PCR are listed in Table S1.

Total RNA was extracted using TRIzol Reagent (Sigma-Aldrich, Merck, Germany). HiScript III All-in-one RT SuperMix (Vazyme, China) was used for cDNA synthesis according to the manufacturer’s instructions. QRT-PCR was performed with SYBR qPCR Master Mix (Vazyme, China) using StepOne Plus (Applied Biosystems, USA) and LightCycler 480 PCR instrument (Roche Diagnostics, Switzerland). The primers and siRNA Oligo used were listed in Additional file 1: Table S1.

Total RNA of the NCCIT cells was extracted by TRIzol (Invitrogen). One μg of RNA was used as a template, and the first-strand complementary DNA (cDNA) synthesis was completed using the Transcriptor First Strand cDNA Synthesis Kit (Roche). Next, the cDNA was processed for qRT-PCR using the LightCycler 480 PCR instrument (Roche), according to the LightCycler 480 SYBR Green I Master (Roche) experimental instructions. The AKT3 mRNA expression level, relative to β-actin, was calculated by the 2^−ΔΔCT method. The primers were designed and synthesized by Shanghai Sangon as follows: AKT3 forward: 5’ – ACCGCACACGTTTCTATGGT-3’, reverse: 5’ – CCCTCCACCAAGGCGTTTAT-3’; β-actin forward: 5’ – TCACCAACTGGGACGACATG-3’, reverse: 5’ – GTCACCGGAGTCCATCACGAT – 3’.

Total RNA was extracted from the treated BV-2 cells with TRIZOL reagent (16096020, Thermo Fisher Scientific, New York, USA). After the RNA samples with the required concentration and purity were diluted to an appropriate concentration, reverse transcription was implemented using the kit (TaKaRa, Tokyo, Japan). Real time PCR was conducted using a LightCycler 480 PCR instrument (Roche, Indianapolis, IN, USA) according to the user manual of a fluorescence quantitative PCR kit (SYBR Green Mix, Roche, Indianapolis, IN, USA) under the following reaction conditions: 35 cycles of pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, annealing at 56°C for 10 s, and extension at 72°C for 20 s. The internal reference was β-actin, and 2^−ΔΔCt method was adopted for data analysis (ΔΔCt = experimental group [Ct target gene − Ct internal control] − control group [Ct target gene − Ct internal control]). Each experiment was run in triplicate. Relevant primers were designed by Sangon Biotechnology Co., Ltd (Shanghai, China) (Table 2).