Illustra rnaspin mini kit

Manufactured by GE Healthcare

Sourced in United Kingdom, United States, Germany, Canada, Italy

The Illustra RNAspin Mini Kit is a laboratory equipment product designed for the efficient extraction and purification of RNA from a variety of sample types. It provides a reliable and consistent method for obtaining high-quality RNA for use in downstream applications.

Automatically generated - may contain errors

Lab products found in correlation

Close spelling variants of this product

Illustra RNAspin Mini Isolation Kit Illustra RNAspin Mini RNA kit Illustra RNAspin Mini RNA Isolation Kit Illustra RNAspin Mini Illustra RNAspin kit RNAspin Mini Kit RNAspin Mini

137 protocols using illustra rnaspin mini kit

Gene Expression Analysis Pipeline

Check if the same lab product or an alternative is used in the 5 most similar protocols

For gene expression analysis, cells were collected on ice after 24 hours of treatment. RNA was isolated using illustra RNA spin mini kit (GE healthcare, Chicago, IL), following the supplier’s instructions. RNA concentration was measured using NanoDrop™ (Thermo Fisher Scientific). cDNA was derived using the qScript™ cDNA Synthesis Kit (Quanta Biosciences, Gaithersburg, MD), cDNA stock concentration was adjusted to 7.14 ng/µl. Each qPCR reaction contained 2.5 µl of stock cDNA, 2.5 ul of 1 µM forward and reverse primer mix and 5 µl of Fast SYBR™ Green master mix (Thermo Fischer Scientific). The qPCR reaction was performed using a Bio-Rad CFX Connect™ Real Time PCR machine (Bio-Rad, Hercules, CA).

Barkovskaya A., Seip K., Hilmarsdottir B., Maelandsmo G.M., Moestue S.A, & Itkonen H.M. (2019). O-GlcNAc Transferase Inhibition Differentially Affects Breast Cancer Subtypes. Scientific Reports, 9, 5670.

+ Open protocol

+ Expand

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For quantitative Reverse-Transcriptase PCR assays, total mRNA from the cells was extracted using Illustra RNA spin Mini kit (GE Healthcare), according to the manufacturer’s instruction and cDNA was made using High-Capacity cDNA reverse-transcription kit (Applied Biosystems, USA). Each PCR reaction consisted of 10 μl of 2X SYBR GREEN Universal master mix (Bio-Rad Laboratories, USA), 5 μl of forward and reverse primers (0.5 μM), and 5 μl of the sterile water diluted cDNA. The qRT-PCR was performed to analyse the expression of RAB2A, NAP1L1, HDX, MBL2, SLITRK3, DSERG1, COL4A3BP, DMBT1, CDC7, MAGEC3, UBE3A and ROCK1P1 on an ABI Step One plus real-time PCR instrument (Applied Biosystems, USA) and relative gene copies or the transcripts were calculated by the ΔΔC_T method as described earlier [19 (link)]. Table 1 lists the primers used for the amplification of target gene sequences. Each experiment included duplicate samples and the data shown represents the mean of three independent experiments.

Kaul R., Purushothaman P., Uppal T, & Verma S.C. (2019). KSHV lytic proteins K-RTA and K8 bind to cellular and viral chromatin to modulate gene expression. PLoS ONE, 14(4), e0215394.

+ Open protocol

+ Expand

qPCR Analysis of Macrophage Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

After infection, total RNA was isolated from macrophages using illustra RNAspin Mini Kit (GE Healthcare, Piscataway, USA) according to the manufacturer's protocol and qPCR was carried out following MIQE guidelines (Bustin et al., 2009 (link)). One microgram of the RNA was converted to cDNA using the GoScript™ Reverse Transcription System (Promega, Madison, WI). The cDNA was subjected to qPCR using the iQTM SYBR® Green Supermix (Bio-Rad Laboratories, Hercules, CA) on an iCycler iQ™ Real-Time PCR Detection System (Bio-Rad). Melt-curve analysis was performed to confirm that the signal was of the expected amplification product. The values for specific genes were normalized to human GAPDH, which was found to be working well with our sample after analysing a set of housekeeping genes in our experimental system. The primers used for qPCR are listed in Table 2 in Supplementary Material. All qPCR primers were purchased from Sigma-Aldrich.

Chandran A., Antony C., Jose L., Mundayoor S., Natarajan K, & Kumar R.A. (2015). Mycobacterium tuberculosis Infection Induces HDAC1-Mediated Suppression of IL-12B Gene Expression in Macrophages. Frontiers in Cellular and Infection Microbiology, 5, 90.

+ Open protocol

+ Expand

Quantifying Gene Expression in LPS-Treated Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols

Stable cell lines were seeded into 12-well cell culture dishes and treated with LPS for indicated times. Total RNA was isolated using illustra RNAspin Mini Kit (GE Healthcare Life Sciences). First-strand cDNA was synthesized by M-MLV reverse transcriptase (Promega) and diluted 5-fold for qPCR. Real-time PCR was performed using Maxima SYBR Green/ROX (Thermo Scientific). All measurements were normalized against GAPDH as the internal control using 2^−ΔΔCt method. The sequences of primers are included in Supplementary Table 7.

Erdoğan Ö., Xie L., Wang L., Wu B., Kong Q., Wan Y, & Chen X. (2016). Proteomic dissection of LPS-inducible, PHF8-dependent secretome reveals novel roles of PHF8 in TLR4-induced acute inflammation and T cell proliferation. Scientific Reports, 6, 24833.

+ Open protocol

+ Expand

Cloning AhR Ligand Binding Domain

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from the human hepatoma cells (HepG2) using IllustraRNAspin Mini Kit (GE Life Sciences) according to the manufacturer's manual. 2 μg of the RNA was reverse-transcribed to the cDNA using Ready-to-Go You-prime first-strand-beads (GE Life Sciences) with oligo-dT^15–18 (Invitrogen). 2 μl of the cDNA was used as a template in a PCR with a pair of specific primers for the AhR(LBD); AhR(BamHI)-F and AhR(EcoRI)-R (Additional file 1: Table S1). Primers were designed to amplify the LBD of the AhR gene and to add BamHI and EcoRI restriction sites at the 5' and 3' ends, respectively. The fragment of LBD was amplified by a high fidelity Taq DNA polymerase (AccuPrime™ Kit; Invitrogen) at 55 °C annealing temperature. Amplified AhR fragment and the pRSET-sfGFP plasmid [28 ] were digested with BamHI and EcoRI (Fermentas) then ligated using the T4 DNA ligase following standard procedures (Fermentas).

Faiad W., Hanano A., Kabakibi M.M, & Abbady A.Q. (2016). Immuno-detection of dioxins using a recombinant protein of aryl hydrocarbon receptor (AhR) fused with sfGFP. BMC Biotechnology, 16, 51.

+ Open protocol

+ Expand

Mouse Transcriptome Profiling by Illumina

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA samples were extracted using the IllustraRNAspin Mini kit (GE Healthcare). Following extraction, RIN (RNA Integrity Number) was >9 (BioAnalyser, Agilent RNA Nano Kit). RNA samples (500 ng) were reverse transcribed with the IlluminaTotalPrep RNA Amplification Kit (Ambion) and copy RNA (cRNA) was generated with 14 hr in vitro transcription reactions and checked at the BioAnalyser. Washing, staining, and hybridization were performed according to standard Illumina protocols. cRNA samples were then hybridized to IlluminaBeadChip Array MouseRefSeq-8 v2. BeadChips were scanned with BeadArray™ Reader in channel 2. The data have been uploaded on the Dryad Digital Repository (Zambrano et al., 2016 ). Experiments were repeated twice.

Zambrano S., De Toma I., Piffer A., Bianchi M.E, & Agresti A. (2016). NF-κB oscillations translate into functionally related patterns of gene expression. eLife, 5, e09100.

+ Open protocol

+ Expand

Quantitative RT-PCR Analysis of Arhgap21

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was purified with Illustra RNAspin Mini Kit (GE Healthcare Life Sciences, UK) and reverse transcribed with RevertAid H minus First Strand cDNA synthesis Kit (ThermoScientific, Inc., USA). Real time quantitative PCR was carried out as previously described (Xavier-Ferrucio et al., 2015 (link)), in an Eppendorf MasterCycler using SYBR green master mix (ThermoScientific, Inc., USA). Gene expression was determined, using specific primers: murine Arhgap21 (NM_001128084) Arhgap21 forward: GAGGAAAGCTTCAAGCACCA, Arhgap21 reverse: GATGACAGC AGATCAGGAA; Hprt forward: GGGGGCTATAAGTTCTTTGCT and HPRT reverse: GGCCTGTATCCAACACTTCG; human ARHGAP21 (NM_020824) ARHGAP21 forward: CAATGGATACCATATTTGTTAAGCAAGTT, ARHGAP21 reverse: CACTTTCTCCATTGACTTTTATAATTCG, HPRT forward: TTGCTTTCCTTGGTCAGGCA and HPRT reverse: TTCGTGGGGTC CTTTTCACC.

Xavier-Ferrucio J., Ricon L., Vieira K., Longhini A.L., Lazarini M., Bigarella C.L., Franchi G J.r., Krause D.S, & Saad S.T. (2017). Hematopoietic defects in response to reduced Arhgap21. Stem cell research, 26, 17-27.

+ Open protocol

+ Expand

Immunoprecipitation and qPCR Analysis of Drosophila Larval Body Wall

Check if the same lab product or an alternative is used in the 5 most similar protocols

For each biological replicate, 10 third instar larval body walls were dissected in HL3 medium and homogenized in immunoprecipitation buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.5% NP-40, 10% glycerol, 1 mini tablet of Complete EDTA-free protease inhibitor [Roche], and RNAsin [Promega]). Lysates were incubated overnight at 4°C with magnetic Dynabeads (Thermo Fisher Scientific) conjugated to guinea pig anti-Syp and IgG antibody. Beads were washed four times briefly with cold lysis buffer. To retrieve the RNA, beads were resuspended in elution buffer (50 mM Tris-HCl, pH 8.0, 10 mM EDTA, 1.3% SDS, and RNAsin) and incubated at 65°C, 1,000 rpm for 30 min on a thermomixer. The elution step was repeated, and the supernatants were pooled. RNA was then extracted using an Illustra RNAspin mini kit (GE Healthcare). Input and eluate samples were used for cDNA synthesis using RevertAid Premium Reverse Transcription (Thermo Fisher Scientific). cDNA was used directly as a template for real-time PCR (SYBR green, Bio-Rad). Primer sequences were as follows: rpl32 forward, 5′-GCTAAGCTGTCGCACAAATG-3′, and reverse, 5′-TCCGGTGGGCAGCATGTG-3′; msp-300 forward, 5′-TGCGCGATAAGGAGCAACAG-3′, and reverse, 5′-ATGAGGAGCTGTTCCGTTTGG-3′.

Titlow J., Robertson F., Järvelin A., Ish-Horowicz D., Smith C., Gratton E, & Davis I. (2020). Syncrip/hnRNP Q is required for activity-induced Msp300/Nesprin-1 expression and new synapse formation. The Journal of Cell Biology, 219(3), e201903135.

+ Open protocol

+ Expand

Quantitative RT-PCR Gene Expression Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

For quantitative Reverse-Transcriptase PCR assays, we extracted the total mRNA from the cells using an illustra RNAspin Mini kit (GE Healthcare) according to the manufacturer’s instructions. Extracted RNA was subjected to cDNA synthesis using a High-Capacity cDNA reverse transcription kit (Applied Biosystems, USA). Each PCR reaction consisted of 10 μl of 2X SYBR PCR master mix (Applied Biosystems), 1μM of each forward and reverse primers and 2μl of the cDNA. The cDNA was amplified on an ABI StepOne plus real-time PCR machine (Applied Biosystems), and the relative gene copies or the transcripts were calculated with the ΔΔC_T method. Each experiment included duplicate samples and the data shown represent the mean of three independent experiments. We calculated P values using two-tailed t-tests with Graphpad (Prism 6, USA) software.

Thakker S., Strahan R.C., Scurry A.N., Uppal T, & Verma S.C. (2017). KSHV LANA upregulates the expression of epidermal growth factor like domain 7 to promote angiogenesis. Oncotarget, 9(1), 1210-1228.

+ Open protocol

+ Expand

Transcriptomic Analysis of Estrogen Signaling

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Hormone-deprived cells were treated in biological quadruplicate with vehicle, E2, 4OHT +/− E2, or fulvestrant +/− E2 as previously described (27 (link)). RNA was isolated using the Illustra RNAspin Mini kit (GE Healthcare, Buckinghamshire, UK). Gene expression was measured on Affymetrix U133A 2.0 arrays. Data were RMA normalized using the affy() package in R (command “rma()”, http://www.bioconductor.org/). Differentially expressed genes were identified with limma. When genes were represented by multiple probes, the probe with greatest variation (largest dynamic range) across samples was chosen for downstream analysis. Heat maps were generated using the Multiple Experiment Viewer (MeV, http://www.tm4.org/mev.html). E2-regulated genes were considered “blocked” by fulvestrant or 4OHT if E2 produced significant (p<0.001) changes in expression compared to vehicle but fulvestrant+E2 or 4OHT+E2 did not. To determine overlap with E2-regulated genes in breast cancer, MCF-7 data was obtained from the GEMS database. Significantly E2-regulated genes were defined as those with q<0.05. Because the treatment for our microarray studies was 3 hours, we used only the “early” (3–4 hour E2 treatment) GEMS data set.
cDNA conversion and qRT-PCR were performed using iScript and Universal SYBR RT Supermix (Bio-Rad, Hercules, CA). Primer sequences are in Table 1.

Andersen C.L., Sikora M.J., Boisen M.M., Ma T., Christie A., Tseng G., Park Y., Luthra S., Chandran U., Haluska P., Mantia-Smaldone G.M., Odunsi K., McLean K., Lee A.V., Elishaev E., Edwards R.P, & Oesterreich S. (2017). Active estrogen receptor-alpha signaling in ovarian cancer models and clinical specimens. Clinical cancer research : an official journal of the American Association for Cancer Research, 23(14), 3802-3812.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!