Mmessage machine sp6 kit

Manufactured by Thermo Fisher Scientific

Sourced in United States

The MMessage Machine SP6 kit is a laboratory tool designed for in vitro transcription. It provides the necessary components to synthesize capped and polyadenylated RNA from DNA templates.

Automatically generated - may contain errors

Lab products found in correlation

Fluorescein lysine dextran, by Thermo Fisher Scientific (4 mentions) Poly a tailing kit, by Thermo Fisher Scientific (3 mentions) Nanodrop 2000 spectrophotometer, by Thermo Fisher Scientific (2 mentions) Dual luciferase reporter assay system, by Promega (2 mentions) Lsm 510 meta, by Zeiss (2 mentions) Slc25a46 morpholino, by Gene Tools (2 mentions) Standard scrambled morpholino, by Gene Tools (2 mentions) Megashortscript t7 kit, by Thermo Fisher Scientific (2 mentions) Ms 222, by Thermo Fisher Scientific (1 mentions) Phenol red, by Merck Group (1 mentions) Rneasy minielute cleanup kit, by Qiagen (1 mentions) Quikchange 2 site directed mutagenesis kit, by Agilent Technologies (1 mentions) Real assembly talen kit, by Addgene (1 mentions) Ambion megascript t7, by Thermo Fisher Scientific (1 mentions) Pcs2 ncas9n, by Addgene (1 mentions) Rneasy mini kit, by Qiagen (1 mentions) Nucaway spin column, by Thermo Fisher Scientific (1 mentions) Qiaprep spin miniprep kit, by Qiagen (1 mentions) Rneasy, by Qiagen (1 mentions) Acti stain 670, by Cytoskeleton (1 mentions)

63 protocols using mmessage machine sp6 kit

Antisense Morpholino-Mediated Knockdown of dhps

Check if the same lab product or an alternative is used in the 5 most similar protocols

The following antisense morpholino (MO) (Gene Tools, LLC) was injected into 1-cell stage embryos: dhps MO (targeting NM_213222), 5′- ACGATCAGTCTGTCACTCACCATCT (1 ng and 2 ng), targeting the splice site at the junction of exon 2 and exon 3. H2BRFP mRNA was transcribed with SP6 mMessage machine kit (Invitrogen), and 100 pg was co-injected into zygotes along with dhps MO. Efficiency of knockdown was determined by RT-PCR, using primers that amplify across the predicted deletion: 5′- GCGCTGTGAAATGTGAGTGAAAC and 5′- GTTTGACGTGTAGCCCAGGAAT. The resultant PCR amplicon was 385 bp in the control embryos and 172 bp in the dhps MO-injected embryos, and was visualized by standard agarose gel electrophoresis.

Mastracci T.L., Robertson M.A., Mirmira R.G, & Anderson R.M. (2015). Polyamine biosynthesis is critical for growth and differentiation of the pancreas. Scientific Reports, 5, 13269.

+ Open protocol

+ Expand

In Vitro Transcription and Electroporation of YFV and SIN Replicons

Check if the same lab product or an alternative is used in the 5 most similar protocols

Linearization of the YFV-Gluc replicon and the SIN-flavi-prME/C packaging constructs was performed with XhoI. Linearized plasmids were transcribed in vitro using the SP6 mMessage Machine Kit (Invitrogen^TM, Thermo Fisher Scientific) according to the manufacturer’s instructions. The integrity and amount of the in vitro transcribed RNA were assessed by electrophoresis in ethidium bromide agarose gels. Electroporation of in vitro transcribed RNA was performed as described previously [39 (link)].

Lücke A.C., vom Hemdt A., Wieseler J., Fischer C., Feldmann M., Rothenfusser S., Drexler J.F, & Kümmerer B.M. (2022). High-Throughput Platform for Detection of Neutralizing Antibodies Using Flavivirus Reporter Replicon Particles. Viruses, 14(2), 346.

+ Open protocol

+ Expand

Morpholino-based Knockdown and Rescue of hook2 in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

A morpholino was designed antisense to the region containing the start-codon of hook2 (GeneTools). 1nl was injected into 1-cell stage pvasa:egfp positive embryos at a concentration of 0.5mM and co-injected with 1/10^th volume of rhodamine dextran. This was also performed using a morpholino targeting the fus transcript at the same concentration. Rescue experiments were performed by mixing 200ng/μL final concentration in the MO injection mix. Hook2 mRNA was amplified using an oligo containing an Sp6 promoter and mismatches at the MO binding site. mRNA was synthesized using the Sp6 mMESSAGE MACHINE kit (Invitrogen), followed by poly-A-tailing using the poly(A) tailing kit (Invitrogen). At 24hpf, the larvae were dechorionated and fixed in 4%PFA/PBS so GFP positive PGCs could be counted at the same developmental stage. 1dpf, embryos were dechorionated and fixed in 4%PFA/PBS and observed through Leica stereo microscope for counting PGCs.

Roovers E.F., Kaaij L.J., Redl S., Bronkhorst A.W., Wiebrands K., de Jesus Domingues A.M., Huang H.Y., Han C.T., Riemer S., Dosch R., Salvenmoser W., Grün D., Butter F., van Oudenaarden A, & Ketting R.F. (2018). Tdrd6a Regulates the Aggregation of Buc into Functional Subcellular Compartments that Drive Germ Cell Specification. Developmental Cell, 46(3), 285-301.e9.

+ Open protocol

+ Expand

Xenopus Embryo Microinjection of HCN4 mRNA

Check if the same lab product or an alternative is used in the 5 most similar protocols

Capped mRNAs were synthesized in vitro using the Sp6 mMessage Machine kit (Invitrogen). Cleavage stage embryos were injected in either the left or right blastomere at the 2-cell stage with mRNAs encoding either 350pg wild-type mouse HCN4 (HCN4-WT) or 500pg dominant-negative mouse HCN4 pore mutant (HCN4-DN[AAA]). Embryos injected with HCN4 mRNAs were co-injected with membrane-bound RFP (300pg) as a lineage tracer.
After microinjection into cleavage stage Xenopus embryos, embryos healed in 1X MMR overnight. Before the onset of gastrulation, the MMR was gradually reduced to 0.1X MMR, and embryos were raised in 0.1X MMR until they reached the desired stage, at which point they were sorted for fluorescent expression to confirm the presence and location of injected constructs. Prior to molecular analysis, embryos were killed with 5% tricaine (pH 7.2, MS-222, Acros Organics) and fixed for 1 hour at room temperature in MEMFA (0.1 M MOPS pH 7.4, 2 mM EGTA, 1 mM MgSO₄, 3.7% formaldehyde).

Pitcairn E., Harris H., Epiney J., Pai V.P., Lemire J.M., Ye B., Shi N.Q., Levin M, & McLaughlin K.A. (2017). Coordinating heart morphogenesis: A novel role for hyperpolarization-activated cyclic nucleotide-gated (HCN) channels during cardiogenesis in Xenopus laevis. Communicative & Integrative Biology, 10(3), e1309488.

+ Open protocol

+ Expand

Embryonic Visualization of Optogenetic Biosensors

Check if the same lab product or an alternative is used in the 5 most similar protocols

For mRNA generation, pCSDest BcLOV-SOS_cat, pCSDest BcLOV-mCherry and pCSDest ERK-KTR-BFP were digested with NotI. mRNA was generated using the SP6 mMessage Machine kit (Invitrogen) according to the manufacturer’s specifications. 400 pg of BcLOV-SOS_cat or BcLOV-mCherry were injected. For the KTR construct, we injected 100 pg. For double injections, mRNAs were mixed prior to injection. Embryos were derived by natural spawning in the morning of injection and injected with the desired construct(s). Imaging was performed at 24 hours post fertilization after embedding the embryos in 1% low melting point agarose in a glass bottom dish. Animal protocols (#806819) were approved by the University of Pennsylvania Institutional Animal Care and Use Committee (IACUC). Wildtype fish of the AB strain were used for experiments at the indicated time points of development. The sex of the animals cannot be determined at the embryonic stage.

Benman W., Berlew E.E., Deng H., Parker C., Kuznetsov I.A., Lim B., Siekmann A.F., Chow B.Y, & Bugaj L.J. (2021). Temperature-responsive optogenetic probes of cell signaling. Nature chemical biology, 18(2), 152-160.

+ Open protocol

+ Expand

Embryonic Visualization of Optogenetic Biosensors

Check if the same lab product or an alternative is used in the 5 most similar protocols

+ Open protocol

+ Expand

One-cell stage mRNA injection

Check if the same lab product or an alternative is used in the 5 most similar protocols

All pCS2(+) plasmids were linearized with NotI and subsequently purified with the E.Z.NA. Cycle Pure Kit (Omega). Capped mRNAs were synthesized with the Sp6 mMessage Machine kit (Invitrogen) using the purified linearized plasmids as templates. Capped mRNAs were then purified with the E.Z.N.A. Total RNA Kit I (Omega). Capped mRNA concentrations were measured using the NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). All kits were used according to respective manufacturer's protocols. If not mentioned otherwise, all mRNAs were injected at 50 pg into embryos at the one-cell stage using standard methods (Westerfield 2000) .

Dingal P.D.P., Carte A.N., Montague T.G., Suan M.B.L., & Schier A.F. (2021). Molecular mechanisms controlling the biogenesis of the TGF-β signal Vg1.

+ Open protocol

+ Expand

Oocyte Isolation and Imaging Protocol

Check if the same lab product or an alternative is used in the 5 most similar protocols

Starting with juvenile ovaries with few late-stage oocytes, we used forceps to manually remove oocytes larger than stage II. Oocyte injections were performed as described (Kobayashi et al, 2021 (link)). The oocytes were embedded in a thin layer of low-melt agarose to immobilize them, and microinjected with a minimal volume of either dextran (final concentration 4 mg/ml) or mRNA. mRNA for injection was generated using the SP6 MMessage Machine kit (ThermoFisher Science AM1340). After injection, oocytes were incubated overnight in L-15 media and then stained with either Mitotracker red at a concentration of 100 nM or DiOC₆ at a concentration of 20 nM for 1 hr followed by two 30 min washes with L-15 media. The layer of agarose was then pressed against a cover slip and imaged using confocal microscopy.

Jamieson-Lucy A.H., Kobayashi M., Aykit Y.J., Elkouby Y., Escobar-Aguirre M., Vejnar C., Giraldez A, & Mullins M.C. (2022). A proteomics approach identifies novel resident zebrafish Balbiani body proteins Cirbpa and Cirbpb. Developmental biology, 484, 1-11.

+ Open protocol

+ Expand

Xenopus Oocyte Expression Assay

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was transcribed using the SP6 mMessageMachine kit (Thermofisher, Milan, Italy) after linearization with MluI. Xenopus laevis oocytes were injected with ~6 ng of RNA and incubated at 18 °C for 2–5 days prior to measurements as described previously [26 (link)].

Palmer E.E., Pusch M., Picollo A., Forwood C., Nguyen M.H., Suckow V., Gibbons J., Hoff A., Sigfrid L., Megarbane A., Nizon M., Cogné B., Beneteau C., Alkuraya F.S., Chedrawi A., Hashem M.O., Stamberger H., Weckhuysen S., Vanlander A., Ceulemans B., Rajagopalan S., Nunn K., Arpin S., Raynaud M., Motter C.S., Ward-Melver C., Janssens K., Meuwissen M., Beysen D., Dikow N., Grimmel M., Haack T.B., Clement E., McTague A., Hunt D., Townshend S., Ward M., Richards L.J., Simons C., Costain G., Dupuis L., Mendoza-Londono R., Dudding-Byth T., Boyle J., Saunders C., Fleming E., El Chehadeh S., Spitz M.A., Piton A., Gerard B., Abi Warde M.T., Rea G., McKenna C., Douzgou S., Banka S., Akman C., Bain J.M., Sands T.T., Wilson G.N., Silvertooth E.J., Miller L., Lederer D., Sachdev R., Macintosh R., Monestier O., Karadurmus D., Collins F., Carter M., Rohena L., Willemsen M.H., Ockeloen C.W., Pfundt R., Kroft S.D., Field M., Laranjeira F.E., Fortuna A.M., Soares A.R., Michaud V., Naudion S., Golla S., Weaver D.D., Bird L.M., Friedman J., Clowes V., Joss S., Pölsler L., Campeau P.M., Blazo M., Bijlsma E.K., Rosenfeld J.A., Beetz C., Powis Z., McWalter K., Brandt T., Torti E., Mathot M., Mohammad S.S., Armstrong R, & Kalscheuer V.M. (2022). Functional and clinical studies reveal pathophysiological complexity of CLCN4-related neurodevelopmental condition. Molecular Psychiatry, 28(2), 668-697.

+ Open protocol

+ Expand

Zebrafish Embryo Fluorescent Labeling

Check if the same lab product or an alternative is used in the 5 most similar protocols

Zebrafish were maintained in accordance with UK Home Office regulations UK Animals (Scientific Procedures) Act 1986, amended in 2013 under project licence P70880F4C. Embryos were obtained from the following strains: wild type, AB strain; Sox10:mG, Tg(–4.9sox10: Hsa.HIST1H2BJ-mCherry-2A-GLYPI-EGFP); Sox10:Fucci, Tg(–4.9sox10:mAGFP-gmnn-2A-mCherry-cdt1); hs:dnSu(H), vu21Tg (hsp70l:XdnSu(H)-myc); hs:Gal4, kca4Tg Tg(hsp70l:Gal4)1.5kca4 (1); UAS:NICD, Tg(UAS:myc-Notch1a-intra)kca3; Sox10:Kalt4, Tg(–4.9sox10: Hsa.HIST1H2BJ-mCherry-2A-Kalt4ER); UAS:dnSu(H), Tg(UAS:dnSu(H)-myc); Tg(h2afva:GFP)kca13; 12XNRE:egfp. Embryos were selected based on anatomical/developmental good health and the expression of fluorescent reporters when appropriate, split randomly between experimental groups and maintained at 28.5°C in E3 medium. Genotyping was performed by PCR of single embryos after imaging when required (UAS:NICD; UAS:dnSu(H); hs:dnSu(H)). Injections were carried at 1–4-cell stage with 30 pg of PCNA-GFP mRNA in a volume of 1 nl. mRNA was synthesised from pCS2 + PCNA GFP plasmid, kindly provided by C. Norden (IGC, Portugal), linearised with NotI and transcribed with the SP6 mMessage Machine Kit (Thermo Fisher Scientific, Cat# AM1340).

Alhashem Z., Feldner-Busztin D., Revell C., Alvarez-Garcillan Portillo M., Camargo-Sosa K., Richardson J., Rocha M., Gauert A., Corbeaux T., Milanetto M., Argenton F., Tiso N., Kelsh R.N., Prince V.E., Bentley K, & Linker C. (2022). Notch controls the cell cycle to define leader versus follower identities during collective cell migration. eLife, 11, e73550.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!