Topo ta cloning vector

The DNA constructs used in this study were generated using cloning free PCR (Erdeniz et al., 1997 (link)). The primers used to generate the PCR fragments are listed in Table 1. Yeast genomic DNA from W303 or B4060 was used as the template to generate the PCR fragments. For each construct two separate PCR fragments were generated. One fragment encompassed the 5′-UTR and ORF and the second fragment contained the 3′-UTR. The 5′-UTR and ORF fragments were then fused to the 3′-UTR fragment using cloning free PCR. The 5′-UTR and ORF fragments generated by PCR were for CYC1 and SSY5 genes using the primers listed in Table 1. The CYC1 5′-UTR and ORF fragment was fused to the SSY5 3′-UTR to generate the CYC1-SSY5 3′-UTR fragment. The SSY5 5′-UTR and ORF was fused to either the CYC1 3′-UTR or the cyc1-512 3′-UTR to generate the SSY5-CYC1 3′-UTR fragment and the SSY5-cyc1-512 3′-UTR fragment respectively. The fusion DNA fragments were then inserted into the TOPO-TA cloning vector according to the manufacturer's instructions (Life Technologies, Grand Island, NY). All DNA fusion constructs generated by PCR were sequenced to confirm that they were error free and that precise fusions were generated. After sequencing the fusion constructs were subcloned out of the TOPO-TA cloning vector and inserted into the high copy yeast vector pRS425 (Sirkosky and Heiter, 1989 (link)).

To investigate the presence of a common HOXB9-miR-196a-1 primary transcript (PT), primers were designed that spanned the 6.3Kb between HOXB9 exon1 and miR-196a-1 precursor transcript (forward: 5’ AATTAGGTAGTTTCATGTTGTTGGGCC 3’; reverse: 5’ ATAATAGCTGCTAAGCGTCCC AGAAAT 3’). For the reverse transcription step, primary transcript primers were used with M-MLV reverse transcriptase (Promega, Southampton, UK), followed by PCR using the same primers (product 6.3kB). Nested primers were designed to give a 295bp product within this transcript (forward: 5’ AAAGTCAGGGCAGGAGAGGGAAGGGGAA 3’, reverse: 5’ CAATTTGCCAGCCCTATGAAGTCTGCT 3’), with RNaseA treated (RNA was incubated for 1 hour at 37°C with 100μg/ml RNaseA (Promega, Southampton, UK) and no-reverse transcriptase (RT) controls. The PCR products were separated on a 2% (w/v) agarose gel, visualised under UV transillumination and purified using gel extraction kit (Bioline, London, UK). This product was then cloned into TOPO TA Cloning vector (Life Technologies, Paisley, UK) and positive colonies were selected using blue/white screening, purified using Isolate plasmid mini kit (Bioline, London, UK) and sequenced.

To identify the genomic-proviral junction sequence, linear amplification-mediated polymerase chain reaction (LAM-PCR) was performed as described previously, with minor modifications [27] (link), [28] (link). In brief, genomic DNA from bone marrow cells was first digested with Tsp509I. A linear amplification of target DNA in the digested genome was performed by repeated primer extension using a vector-specific 5′-biotinylated primer, LTR1.5, and Taq polymerase. After selection with Dynabeads MyOne Streptavidin C1 (Life Technologies), a double-stranded asymmetrical linker cassette was ligated to the Tsp509I-digested site using T4 DNA Ligase. The DNA products were then amplified by PCR using a vector-specific primer, LTR3, and linker cassette primer, LC1. The nested PCR was performed using internal primers LTR5 and LC2. The final products were sequenced after cloning them into the TOPO TA cloning vector (Life Technologies). The primer sequences are shown in Table S1.

Genomic DNA was isolated from cells by using the DNeasy Blood and Tissue Kit (Qiagen) following the manufacturer's instructions. For detection of TET1 CpG island methylation, genomic DNA was subjected to digestion with the methylation-sensitive enzyme HpaII (New England Bioloabs) and the methylation-insensitive enzyme MspI (New England Bioloabs) for 16 hrs at 37°C. Products from digestion were diluted and used as template for PCR reactions performed by using 5 PRIME MasterMix (5 PRIME) with specific primers (reported in Supplementary Methods). For bisulfite sequencing assay, genomic DNA was converted by using EZ DNA Methylation Kit (Zymo research). Amplification of the region of interest in TET1 CpG island was performed using 5 PRIME MasterMix (5 PRIME) and a specific primer pair (reported in Supplementary Methods). Fragment cloning was performed using TOPO TA-cloning vector (Life Technologies) and individual inserts from randomly selected clones were sequenced.

We amplified by PCR a 356-bp cDNA fragment of the assembled LINE from bp 1512 to bp 1868 using the following primers:

LINE forward 5′-GGGTCAGAAAGTGACGAGGA-3′

LINE reverse 5′-TGCATGAGGCGGAGTTTAG-3′

The choice of the fragment and the design of primers have been based on manual curation steps ensuring that the chosen fragment is present exclusively in the transcript of the identified LINE element and in no other assembled transcripts. The amplified fragment was cloned into TOPO® TA Cloning® vector (Life Technologies, CA, USA) according to the manufacturer’s protocol. Cloned fragment was digested using BAMHI and ECORV restriction enzymes and validated by Sanger sequencing. Sense and antisense digoxigenin-labeled RNA probes were generated by in vitro transcription using the DIG-RNA Labeling Kit (SP6/T7; Roche Applied Sciences, QC, Canada). Labeled RNA probes were quantified by dot blot analysis.