SLC1A3 cDNA was amplified from the pLX304‐SLC1A3 plasmid kindly gifted by Roderick Beijersbergen (Amsterdam, the Netherlands) using the following primer sequences: 5′‐ACAGCGTCTAGACCGGTTAGCGCTAGCTCATTAC‐3′ and 5′‐CGACAGTTAGCCAGAGAGCTCGCGGCCGCCGCTGT‐3′. The resulting product was digested using XbaI (Roche) and NotI (Thermo Fisher Scientific) restriction enzymes and ligated into a pLenti backbone (Korkmaz et al, 2016 ) with compatible sticky ends.
Xbai
Manufactured by Roche
Sourced in United States, Germany, Switzerland
XbaI is a Type II restriction enzyme that recognizes and cleaves the palindromic DNA sequence 5'-TCTAGA-3'. It is commonly used in molecular biology for DNA manipulation, analysis, and recombinant DNA technology.
Automatically generated - may contain errors
Lab products found in correlation
Chef dr 3 system, by Bio-Rad (6 mentions)
Chef mapper, by Bio-Rad (4 mentions)
Qiaprep spin miniprep kit, by Qiagen (3 mentions)
Seakem gold agarose, by Lonza (3 mentions)
Chef dr 2 system, by Bio-Rad (2 mentions)
Bamhi, by Roche (2 mentions)
Ecori, by Roche (2 mentions)
Hindiii, by Roche (2 mentions)
Xhoi, by Roche (1 mentions)
Hygromycin b, by Thermo Fisher Scientific (1 mentions)
Fugene hd reagent, by Promega (1 mentions)
Xbai, by Promega (1 mentions)
Anti flag m2 affinity resin, by Merck Group (1 mentions)
Agarose gel, by Bio-Rad (1 mentions)
Gel doc, by Bio-Rad (1 mentions)
Chef mapper xa system, by Bio-Rad (1 mentions)
Reddymix pcr master mix, by Thermo Fisher Scientific (1 mentions)
Pcr purification kit, by Qiagen (1 mentions)
Pbad topo ta expression kit, by Thermo Fisher Scientific (1 mentions)
Fast link dna ligase kit, by Illumina (1 mentions)
34 protocols using xbai
1
Cloning of SLC1A3 cDNA into pLenti
2
Clonality Confirmation of IMP-4-Producing E. cloacae
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pulsed-field gel electrophoresis (PFGE) was performed to confirm the clonality of the IMP-4-producing E. cloacae isolates. XbaI (Roche, Mannheim, Germany)-digested genomic DNA was prepared at 37°C for 12–14 h. DNA fragments were separated using a CHEF-DRII System (Bio-Rad, Hercules, CA, USA). Banding patterns were analyzed with InforQuestFP software version 4.5 (Bio-Rad) to generate a dendrogram.
3
Identifying Cold-Tolerant Clones from Metagenomic Libraries
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Recombinant plasmids from the metagenomic libraries constructed in E. coli DH10B cells were extracted using the QIAprep Spin Miniprep kit (Qiagen) and 100 ng of them were used to transform electrocompetent cells of E. coli DH10B ΔcsdA and DH10B ΔcsdA Δrnr, which had been previously prepared according to Dower et al., 1988 (link). To amplify the libraries, after electroporation, the transformed cells were grown in liquid LB-Ap medium at 37°C to increase the number of viable cells around 104 times. To select for cold-tolerant clones, a total of 3 × 106 recombinant clones from each library were spread on LB agar supplemented with Ap, X-Gal, and IPTG (around 105 cells per plate) and incubated at 15°C during 3–5 days until the appearance of colonies. To ensure that the resistance phenotype was not due to the presence of spontaneous chromosomal mutations, resistant colonies were pooled, and their plasmid DNA were isolated and used to transform DH10B ΔcsdA or DH10B ΔcsdA Δrnr cells. The new retransformed clones were grown again at 15°C on LB agar (Ap, X-Gal, IPTG) medium. Cold-tolerant clones were selected and their isolated recombinant plasmids were digested with XhoI and XbaI (Roche) to identify those which are unique in their restriction patterns.
4
Genotyping of Gram-Negative Bacteria by PFGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
E. coli, K. pneumoniae, E. cloacae, Citrobacter freundii, and Serratia marcescens isolates were first genotyped by PFGE using XbaI (Roche Diagnostics, Meylan, France) as previously described [27 (link)]. The Bionumerics software (Applied Math, Kortrijk, Belgium) created a DNA similitude matrix based on calculating the Dice profile for pairwise comparison of strains. The dendrogram was built by using the UPGMA (Unweighted Pair Group using Arithmetic Averages) hierarchical algorithm. Pulsotypes were defined according to international recommendations [28 (link)]. We applied the threshold of 75% to define the same pulsotype. A PFGE pattern represented by one isolate was called ‘single pulsotype’, while a PFGE pattern shared by ≥2 isolates from several patients was called ‘major pulsotype’. The pulsotypes of all the isolates of the present collection have been determined in the same laboratory, between May and July 2017.
5
Pulsed-field Gel Electrophoresis for Molecular Typing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pulsed-field gel electrophoresis was performed using the standardized PulseNet protocol published previously (Gerner-Smidt and Scheutz, 2006 (link)). Briefly, agarose-embedded DNA was digested with 50 U of XbaI (Roche Diagnostics GmbH, Mannheim, Germany) for 4 h at 37°C. The restriction fragments were separated by electrophoresis in 0.5 × Tris-borate-EDTA buffer containing 50 μM thiourea at 14°C for 19 h by the use of a CHEF DR-III system (Bio-Rad, Munich, Germany), with pulse times of 2.16 to 54.17 s. XbaI-digested DNA of Salmonella enterica serovar Braenderup strain H9812 (Centers for Disease Control and Prevention, Atlanta, GA) was used as a molecular size marker. Similarities between restriction patterns were calculated with BioNumerics software (version 6.6, Applied Maths, Ghent, Belgium) using the Dice coefficient with band matching parameters of 1.0% optimization and 1.5% position tolerance. Interstrain relationships were assessed by cluster analysis using the Unweighted Pair-Group with Mathematical Average (UPGMA) method.
6
Pulsed-Field Gel Electrophoresis for Salmonella Genotyping
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pulsed-field gel electrophoresis (PFGE) was conducted for macrorestriction analysis of the isolates and the determination of the plasmid content, as previously described (21 (link)). Macrorestriction analysis was performed by incubating agarose plugs of the isolates with XbaI (Roche Diagnostics, Mannheim, Germany) for 4 h at 37°C. Electrophoresis was carried out with an electric field of 6 V/cm and an angle of 120°. Pulsed-field agarose gels (0.8%) were run at 14°C in 0.5× Tris-borate-EDTA (TBE) buffer. Pulse times ranged from 4 to 40 s for 21 h. For the determination of the plasmid content, the agarose plugs were incubated with S1 nuclease for 45 min at 37°C. Here, the pulse times ranged from 1 to 25 s for 17 h. In general, the Salmonella Braenderup strain H9812 was used as a standard marker (21 (link)).
7
Engineered MsbA-MD expression protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
To express N terminally His-tagged MsbA-MD, the corresponding region of the msbA gene from E. coli was PCR-amplified from pNZMsbA15 (link) with the forward primer 5′- GGAGGCACTCACCATGGGC -3′ and the reverse primer 5′- CGGATAAGTTCTAGATTAATTGCGGAATTCCACGTCGGC -3′ to insert a TAA stop codon after the codon for N346, equivalent to H353 in previous work on LmrA22 (link), followed by an XbaI site at the 3′ end. NcoI and XbaI (Roche Applied Science, Herts, UK) were used to digest the PCR product, which was followed by ligation of the DNA fragment into the linearized vector pNZ8048 downstream of the nisA promoter, yielding pNZMsbA-MD. For the generation of pNZMsbA-DED (D41N E149Q D252N) the following primers were used: D41N (forward) 5′- GCCAGCAAC ACCTTCATGTTATCGCTCC -3′, (reversed) 5′- AAGGTGTT GCTGGCTGCGTTGAGGATTA -3′; E149Q (forward) 5′- TGTGCGTCAA GGTGCGTCGATCATCGGC -3′, (reversed) 5′- ACGCACCTTG ACGCACAACAGTAATCAG -3′; D252N (forward) 5′- CATCTCTAAT CCGATCATTCAGCTGATC -3′, (reversed) 5′- TGATCGGATT AGAGATGGAAGAGGCTGA -3′. The DNA was sequenced to ensure that only the intended changes were introduced.
8
Pulsed Field Gel Electrophoresis for Bacterial DNA Analysis
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Pulsed field gel electrophoresis was performed as described elsewhere (Pei et al., 2008 (link)), with minor modifications. In brief, bacterial cells on an agar medium were suspended in 200 μl of distilled water, and the samples were mixed with an equal amount of 1% SeaKem Gold agarose (Lonza, Basel, Switzerland) to induce plug formation. After appropriate preparations for restriction endonuclease digestion, the DNA in each plug was digested with 30 U of XbaI (Roche Diagnostics, Basel, Switzerland) at 37°C for 2.5 h. The PFGE was performed using a CHEF DRIII system (Bio-Rad Laboratories, Hercules, CA, USA) with the following run parameters: a switch time of 2.2–54.2 and a run time of 21 h. Salmonella enterica serovar Braenderup H9812 was used as the size standard. Analysis in BioNumerics 6.6 (Applied Math, Kortrijk, Belgium) was performed with a 1% position tolerance. An unweighted pair group method with arithmetic mean (UPGMA) clustering algorithm was used to create a hierarchical dendrogram, and the genetic similarity between the isolates was calculated using the Dice coefficient.
9
Recombinant IL-10 Protein Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Nucleotide sequences for the BPSV, RDPV, PCPV, and GSPV IL-10 genes were modified in SnapGene to include the Kozak translation initiation sequence at the N-terminal methionine and the FLAG octapeptide sequence followed by a stop codon at the C-terminus, flanked by the restriction enzyme sites for BamHI and XbaI, respectively (Table S1 ). Modified genes in the pUC57 plasmid were ordered from GenScript (Piscataway, NJ, USA). The vectors containing the IL-10 genes were digested with BamHI and XbaI (Roche, Basel, Switzerland), then the gene fragments were ligated into the BamHI and XbaI sites generated in the expression vector, pAPEX-3.
HEK-293-EBNA cells were transfected with pAPEX-3-IL-10 constructs using FuGENE®-HD reagent (Promega, Madison, WI, USA), then selected using hygromycin B (Gibco, Gaithersburg, MD, USA). Conditioned medium was collected and clarified by centrifugation prior to purification of the FLAG-tagged IL-10 proteins by affinity chromatography with anti-FLAG® M2 affinity resin (Sigma-Aldrich, St. Louis, MO, USA). FLAG-tagged human and ORFV IL-10 were produced in a similar manner, as previously described [33 (link),42 (link)].
HEK-293-EBNA cells were transfected with pAPEX-3-IL-10 constructs using FuGENE®-HD reagent (Promega, Madison, WI, USA), then selected using hygromycin B (Gibco, Gaithersburg, MD, USA). Conditioned medium was collected and clarified by centrifugation prior to purification of the FLAG-tagged IL-10 proteins by affinity chromatography with anti-FLAG® M2 affinity resin (Sigma-Aldrich, St. Louis, MO, USA). FLAG-tagged human and ORFV IL-10 were produced in a similar manner, as previously described [33 (link),42 (link)].
10
Salmonella Serotype Braenderup PFGE
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!