Chromatin immunoprecipitation kit

ChIP was performed using a chromatin immunoprecipitation kit (Epigentek, Farmingdale, NY, US). In brief, rat colon crypts and Caco-2/BBe cells were cross-linked using 1% formaldehyde and terminated by incubation with 0.125 mol/L glycine for 5 min. The cell lysate was incubated for 10 min at 4 °C and the crude nuclear extract was collected by centrifugation at 600 g for 5 min at 4 °C. The DNA was sonicated to random fragments between 200 and 500 bps. The chromatin was subjected to immunoprecipitation using the following antibodies: NR3C1 (#3660; Cell Signaling Technology, Danvers, MA, US), HES1 (#sc-1004; Santa Cruz Biotechnology, Dallas, TX, US). Normal rabbit IgG was used as a control. DNA was eluted in elution buffer and used for PCR amplification. Primers for rat CLDN1 promoter: forward-GGACCCTTGTGGGGATTTG, reverse- CCAGGAGGTTAGCGCTGATAC and human CLDN1 promoter: forward-GATAATTGGAGTGAATGAATGAAAAG, reverse-GTTTCAGGGCGGCTCAC are bought from Life Technologies (Grand Island, NY, US).

The ChIP assay was performed using anti-C-FOS antibody (Santa Cruz Biotechnology, CA) and the Chromatin Immunoprecipitation Kit (Epigentek, NY) per the manufacturer’s instructions. Enrichment analysis was carried out using real-time PCR with specific primers.