Twenty-five millilitres of wild-type (BGSC strain 1A1 wild type: trpC2) and isogenic rnrΔ cells (BGSC BKK33610 trpC2; Δrnr::kan) were grown in LB medium at 37 °C and 145 rpm, then collected at OD600 nm = 1.4 and lysed in 250 µl of 20 mM HEPES-Na pH 7.5, 100 mM NH4Cl, 10 mM magnesium acetate and 0.5 mM TCEP with 0.1 mm Zirconia-glass beads (Carl Roth) using a FastPrep-24 (Millipore). Clarification was performed at 14,000 rpm and 4 °C for 10 min. The supernatants were transferred to a fresh tube and a volume corresponding to 10 optical density units (OD260 nm) was layered on top of a 10–40% (w/v) linear sucrose gradient and spun for 18.5 h at 19,000 rpm in a SW40 Ti rotor (Beckman Coulter). The ribosome profiles were then measured using a gradient station (Biocomp). For the northern blot analysis of RNA extracted from sucrose gradient fractions, control total RNA of wild-type and ΔqyeH (BGSC BKE25670; trpC2, ΔyqeH::erm) cells was used. Cells were grown to OD600 nm = 1.4 in LB medium at 37 °C and 145 rpm.
Zirconia glass beads
Manufactured by Carl Roth
Sourced in Germany
Zirconia-glass beads are a type of laboratory equipment used for various applications. They are composed of a zirconia core encased in a glass shell, providing a durable and versatile material. The core function of zirconia-glass beads is to serve as a grinding and dispersing medium in various laboratory processes.
Automatically generated - may contain errors
Lab products found in correlation
Fastprep 24, by Merck Group (2 mentions)
Qiaamp dna stool mini kit, by Qiagen (2 mentions)
Tissuelyser system, by Qiagen (2 mentions)
Sw40ti rotor, by Beckman Coulter (1 mentions)
Gradient station, by BioComp Instruments (1 mentions)
Nupage gel, by Thermo Fisher Scientific (1 mentions)
Trans blot turbo transfer pack, by Bio-Rad (1 mentions)
Trans blot turbo machine, by Bio-Rad (1 mentions)
Monoclonal anti flag m2 hrp antibody, by Merck Group (1 mentions)
Chemidoc imaging system, by Bio-Rad (1 mentions)
Clarity western ecl substrate, by Bio-Rad (1 mentions)
Bradford assay, by Bio-Rad (1 mentions)
Miseq machine, by Illumina (1 mentions)
Minilys homogenizer, by Bertin Technologies (1 mentions)
Qiacube system, by Qiagen (1 mentions)
6 protocols using zirconia glass beads
1
Ribosome Profiling of Wild-type and rnr Mutant Cells
2
Western Blot Analysis of Flag-Tagged Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Fifty millilitres of cell culture was grown to an OD600 nm of 1.4 in LB medium at 37 °C with shaking at 145 rpm. The cells were collected and lysed in 250 µl of 20 mM HEPES-Na pH 7.5, 100 mM NH4Cl, 10 mM magnesium acetate and 0.5 mM TCEP with 0.1 mm Zirconia-glass beads (Carl Roth) using a FastPrep-24 (Millipore). Clarification was performed at 14,000 rpm and 4 °C for 10 min. The supernatants were transferred to a fresh tube and samples we normalized by measurement of the absorption at 260 nm. The samples were run on 4–12 % NuPAGE gel (Invitrogen) and blotted using a Trans-blot Turbo transfer pack (Bio-Rad) on a Bio-Rad Trans-Blot Turbo machine for 7 min. The membrane was stained at first with Ponceau S, photographed and then blocked with 5% skimmed milk in TBS–Tween (0.1%) for 30 min. The membrane was then incubated overnight with monoclonal anti-Flag M2–HRP antibody (Sigma, A8592) diluted 1:2,000 in 5% skimmed milk/Tris-buffered saline with 0.1% Tween-20 (v/v) (TBST). After washing twice with 5% skimmed milk/TBST and once with TBST, the signal was developed with Clarity Western ECL substrate (Bio-Rad) and visualized using the Bio-Rad ChemiDoc Imaging system.
3
Expression and Purification of Recombinant Proteins
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The pCoofy4 expression vectors were transformed by heat-shock into E. coli BL21. Bacteria were grown overnight at 25 °C in auto-induction media [33 (link)] and harvested at an OD600 8–12 by centrifugation at 3000 g for 10 min at 4 °C. Cell pellets were resuspended in lysis buffer (100 mM NaCl, 50 mM Tris–HCl pH7.5, 10 mM MgCl2) to an OD600 of 6 and lysed by bead milling using 0.1 mm diameter Zirconia/glass-beads (Carl-Roth) in a tissue lyzer (Precellys) twice at 5600 rpm for 30 s. Cell debris was removed by centrifugation and protein concentration was determined by Bradford assay (Biorad). Successful expression and solubility of recombinant proteins were assessed by SDS-PAGE. Lysates were stored at −20 °C in 10 % glycerol.
4
Gut Microbiome Analysis via 16S rRNA Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The DNA extraction and 16S rRNA gene sequencing were also performed as described in our previous study examining the effects of RSF on the gut microbiota of weaner piglets8 (link), for comparability of the results from these two studies.
The digesta samples were processed for DNA extraction using QIAamp DNA Stool Mini Kit (Qiagen, GmbH, Hilden, Germany) protocol of the QIAcube system (Qiagen, GmbH, Hilden, Germany). The kit protocol was followed after a step of bead beating with zirconia/glass beads (diameter, 0.1 mm, Carl Roth, Karlsruhe, Germany) at 30 Hz for 2 min using the TissueLyser system (Qiagen Retsch GmbH, Hannover, Germany).
Quantification of the extracted DNA was performed by Qubit 3.0 Fluorometer using dsDNA Broad Range Assay Kit (Invitrogen, Eugene, OR, USA) and sent to GATC Biotech AG (Konstanz, Germany) for library preparation and sequencing of the V1-V3 variable region of 16S rRNA gene on Illumina MiSeq machine (Illumina, San Diego, CA, USA). This region was amplified using 27 F (AGAGTTTGATCCTGGCTCAG) and 534 R (ATTACCGCGGCTGCTGG) primers with output of 2 × 300 base-pair paired-end reads.
The raw sequencing files (fastq) have been deposited in the NCBI Sequence Read Archive (SRA) database (BioProject ID: PRJNA591752).
The digesta samples were processed for DNA extraction using QIAamp DNA Stool Mini Kit (Qiagen, GmbH, Hilden, Germany) protocol of the QIAcube system (Qiagen, GmbH, Hilden, Germany). The kit protocol was followed after a step of bead beating with zirconia/glass beads (diameter, 0.1 mm, Carl Roth, Karlsruhe, Germany) at 30 Hz for 2 min using the TissueLyser system (Qiagen Retsch GmbH, Hannover, Germany).
Quantification of the extracted DNA was performed by Qubit 3.0 Fluorometer using dsDNA Broad Range Assay Kit (Invitrogen, Eugene, OR, USA) and sent to GATC Biotech AG (Konstanz, Germany) for library preparation and sequencing of the V1-V3 variable region of 16S rRNA gene on Illumina MiSeq machine (Illumina, San Diego, CA, USA). This region was amplified using 27 F (AGAGTTTGATCCTGGCTCAG) and 534 R (ATTACCGCGGCTGCTGG) primers with output of 2 × 300 base-pair paired-end reads.
The raw sequencing files (fastq) have been deposited in the NCBI Sequence Read Archive (SRA) database (BioProject ID: PRJNA591752).
5
All-trans-Retinal Extraction from Yeast Cells
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For all-trans-retinal extraction a freshly grown overnight culture (YPD +100 mM KCl) of cells was harvested by centrifugation (5 min, 4000 rpm, 4°C). The pellet was washed twice with ice cold 5 mL ddH2O and the supernatant was removed. The pellet was resuspended in 1 mL 100% EtOH and transferred in a 1.5 mL reaction tube. 500 μl of 0.5 mm Zirconia/glass beads (Carl Roth) were added and the cells were homogenized three times for 60 sec on a Minilys® Homogenizer (Bertin Technologies). After each round of bead beating the suspension was cooled on ice for 60 sec. The suspension was centrifuged (1 min, 13000 rpm, 4°C) and the supernatant containing the carotenoids was transferred to a vial for UPLC analysis. The vial was anaerobized using 4 times alternating degassing by a vacuum pump and gassing with nitrogen.
6
DNA Extraction from Digesta Samples
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA extraction from the digesta samples was carried out using QIAamp DNA Stool Mini Kit (Qiagen, GmbH, Hilden, Germany) protocol of the QIAcube system (Qiagen, GmbH, Hilden, Germany). The kit protocol was followed after an additional step of bead beating at 30 Hz for 2 min using the TissueLyser system (Qiagen Retsch GmbH, Hannover, Germany). For bead beating, zirconia/glass beads (diameter, 0.1 mm, Carl Roth, Karlsruhe, Germany) were used.
The extracted DNA from the digesta samples was measured by Qubit® fluorometer using dsDNA BR or HS Assay Kits (Invitrogen, Eugene, OR, USA), and sent to GATC Biotech AG (Konstanz, Germany) for library preparation and sequencing of the 16S rRNA gene for microbiota profiling. The V1-V3 variable region of bacterial 16S rRNA gene was amplified using27F (AGAGTTTGATCCTGGCTCAG) and 534R (ATTACCGCGGCTGCTGG) primers with output of 2 x 300 base-pair paired-end reads.
The fastq files have been deposited in the SRA (Bioproject ID: PRJNA427098 and Accession number: SRP127551).
The extracted DNA from the digesta samples was measured by Qubit® fluorometer using dsDNA BR or HS Assay Kits (Invitrogen, Eugene, OR, USA), and sent to GATC Biotech AG (Konstanz, Germany) for library preparation and sequencing of the 16S rRNA gene for microbiota profiling. The V1-V3 variable region of bacterial 16S rRNA gene was amplified using
The fastq files have been deposited in the SRA (Bioproject ID: PRJNA427098 and Accession number: SRP127551).
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!