Realplex system

Manufactured by Eppendorf

Sourced in United States, France, Germany

The Realplex system is a real-time PCR thermal cycler designed for quantitative gene expression analysis and DNA detection. It provides accurate temperature control and efficient thermal cycling for reliable and reproducible results.

Automatically generated - may contain errors

Lab products found in correlation

Iq sybr green supermix, by Bio-Rad (11 mentions) Trizol, by Roche (9 mentions) Primescript rt reagent kit with gdna eraser, by Takara Bio (8 mentions) Nanodrop 2000, by Thermo Fisher Scientific (4 mentions) Master mix plus for sybr assay, by Eurogentec (4 mentions) Mmlv reverse transcriptase and random hexamer primers, by Promega (3 mentions) Takara one step rna pcr kit amv, by Takara Bio (2 mentions) Rnaiso plus, by Takara Bio (2 mentions) Rneasy kit, by Qiagen (2 mentions) Trizol reagent, by Merck Group (2 mentions) Random hexamer primer, by Promega (2 mentions) Nucleospin rna, by Macherey-Nagel (2 mentions) Nucleospin rna l, by Macherey-Nagel (2 mentions) Rneasy mini kit, by Qiagen (2 mentions) Sybr green pcr master mix, by Thermo Fisher Scientific (2 mentions) Trizol, by Thermo Fisher Scientific (2 mentions) Retroscript reverse transcription kit, by Thermo Fisher Scientific (1 mentions) Ribopure rna extraction kit, by Thermo Fisher Scientific (1 mentions) Biorupter, by Diagenode (1 mentions) Protein g magnetic beads, by New England Biolabs (1 mentions)

31 protocols using realplex system

Quantifying Gene Expression by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted using RNAiso Plus (Takara Bio, China) following the manufacturer's instructions. The cDNA was synthesized from total RNA by TaKaRa One Step RNA PCR Kit (AMV) (Takara Bio, China). Relative expressions of different genes were detected by the PowerUp SYBR Master Mix Applied Biosystems (Invitrogen, USA). Each PCR reaction was run in at least 3 independent experiments using the Eppendorf Realplex system (Eppendorf AG, Germany). The comparative Ct method (ΔCt) was applied to calculate the relative expression levels, which was then normalized by the expression of β-actin. The primer sequences were either designed on the NCBI website (http://www.ncbi.nlm.nih.gov/tools/primer-blast) and the PrimerBank website (http://pga.mgh.harvard.edu/primerbank/). The primers used are listed as follows:
FAP: forward 5'ATGAGCTTCCTCGTCCAATTCA3'; reverse 5'AGACCACCAGAGAGCATATTTTG3'; HIF-1-α: forward 5'GAACGTCGAAAAGAAAAGTCTCG3'; reverse 5'CCTTATCAAGATGCGAACTCACA3'; β-actin: forward 5'CATGTACGTTGCTATCCAGGC3'; reverse 5'CTCCTTAATGTCACGCACGAT3'.

Zou B., Liu X., Zhang B., Gong Y., Cai C., Li P., Chen J., Xing S., Chen J., Peng S., Pokhrel B., Ding L., Zeng L, & Li J. (2018). The Expression of FAP in Hepatocellular Carcinoma Cells is Induced by Hypoxia and Correlates with Poor Clinical Outcomes. Journal of Cancer, 9(18), 3278-3286.

+ Open protocol

+ Expand

Quantifying Uterine Microbiome in Infertility

Cited 1 time

Check if the same lab product or an alternative is used in the 5 most similar protocols

Concentration of DNA from uterine cavity samples of 15 infertile patients and 15 healthy controls, and four reagents for DNA extraction, product purification, exonuclease, and DNA sequencing, were measured spectrophotometrically using a NanoDrop 2000 (Thermo Fisher, USA). The four reagents were used as negative controls. The real-time PCR assay was performed using primers to amplify the 16S rRNA genes and beta-actin. The primers were listed as follows (Ma et al., 2013 (link)): Lactobacillus crispatus: forward primer 5′-AGCGAGCGGAACTAACAGATTTAC-3′, reverse primer 5′-AGCTGATCATGCGATCTGCTT-3′; Lactobacillus iners: forward primer 5′-AGTCTGCCTTGAAGATCGG-3′, reverse primer 5′-CTTTTAAACAGTTGATAGGCATCATC-3′; beta-actin: forward primer 5′-AAAAGCCACCCCACTTCTCT-3′, reverse primer 5′-CTCAAGTTGGGGGACAAAAA-3′. The 20-μl PCR mixture contained 1 μl of DNA sample, 1 μl of each primer, 6 µl of ultra-pure water and 12 µl of 2*SYBR Green Mix. The Eppendorf realplex system (Eppendorf, USA) was used with the thermal cycling profile of 95°C for 5 min, and 40 cycles of 95°C for 30 s, 56°C for 30 s, and 72°C for 30 s. Each sample had three technical replicates. The abundance of the bacterium was calculated by dividing the average CT value of 16S rRNA gene by that of beta-actin.

Sun N., Ding H., Yu H., Ji Y., Xifang X., Pang W., Wang X., Zhang Q, & Li W. (2021). Comprehensive Characterization of Microbial Community in the Female Genital Tract of Reproductive-Aged Women in China. Frontiers in Cellular and Infection Microbiology, 11, 649067.

+ Open protocol

+ Expand

Quantitative Real-Time PCR Analysis of Candida albicans

Check if the same lab product or an alternative is used in the 5 most similar protocols

C. albicans cells were grown overnight in 3ml of YPD and adjusted to a 3 × 10⁶ cells/ml subculture. The cells were then incubated for two h in YPD at 30°C for yeast phase growth and in RPMI at 37°C for hyphal growth. Total RNAs were extracted with RiboPure RNA extraction kit following the manufacturer’s protocol (Ambion). cDNAs were synthesized from 1 μg of total RNAs with Retroscript Reverse Transcription Kit (Ambion) following the manufacturer’s protocol. Quantitative real-time PCR was carried out using 5-Prime SYBR green PCR kit (Thermo Fisher Scientific) and Eppendorf Realplex System (Eppendorf) following the manufacturers’ protocol. The primers used in this study are listed in S2 Table. Relative gene expression was calculated by the 2^ΔΔCT method [47 (link)] using the transcript level of CaACT1 as the endogenous control [37 (link)].

Jung S.I., Rodriguez N., Irrizary J., Liboro K., Bogarin T., Macias M., Eivers E., Porter E., Filler S.G, & Park H. (2017). Yeast casein kinase 2 governs morphology, biofilm formation, cell wall integrity, and host cell damage of Candida albicans. PLoS ONE, 12(11), e0187721.

+ Open protocol

+ Expand

ChIP Protocol for Brn1-3V5 Immunoprecipitation

Check if the same lab product or an alternative is used in the 5 most similar protocols

Chromosome immunoprecipitation (ChIP) was performed as previously described [37 (link)] with the following modifications. For asynchronous and nocodazole-arrested cultures, 40 optical densities (ODs) of each culture were lysed in a Mini-Beadbeater (Biospec) and lysates were sonicated using a Diagenode Biorupter. For alpha-factor arrested cultures, 70 OD were used. Brn1-3V5 was immunoprecipitated with mouse anti-V5 (ThermoFisher) coupled to Protein G magnetic beads (New England Biolabs). Eluted DNA was quantified by qPCR on an Eppendorf Realplex system. Primers used for qPCR are listed in S2 Table.

Doughty T.W., Arsenault H.E, & Benanti J.A. (2016). Levels of Ycg1 Limit Condensin Function during the Cell Cycle. PLoS Genetics, 12(7), e1006216.

+ Open protocol

+ Expand

Quantification of Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Total RNA was extracted from 30 to 50 embryos per group in Trizol reagent (Cat. No. 11667157001, Roche) according to the manufacturer’s instructions. RNA was reverse transcribed using the PrimeScript RT Reagent Kit with gDNA Eraser (Cat. No. RR047A, Takara). Quantification of gene expression was performed in triplicate using Bio-rad iQ SYBR Green Supermix (Cat. No. 1708880, Bio-rad) with detection on the Realplex system (Eppendorf). Relative gene expression quantification was based on the comparative threshold cycle method (2^–ΔΔCt) using ef1α or β-actin as an endogenous control gene. qPCR on HUVECs was performed using similar procedures. All of the primers are listed in Supplementary Table 1.

Luo H., Zhang Y., Deng Y., Li L., Sheng Z., Yu Y., Lin Y., Chen X, & Feng P. (2021). Nxhl Controls Angiogenesis by Targeting VE-PTP Through Interaction With Nucleolin. Frontiers in Cell and Developmental Biology, 9, 728821.

+ Open protocol

+ Expand

Macrophage Migration in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

To evaluate macrophage migration in zebra sh, fertilized one-cell embryos of TG(zlyz:EGFP) transgenic lines were injected with 4ng adcy9-e3i3-MO or control-MO. After treatment, all embryos were incubated at 28.5°C. At 6 dpf, embryos were anesthetized with 0.016% MS-222 (tricaine methanesulfonate, Sigma-Aldrich, St. Louis, MO) and the number of macrophages recruited to the heart was counted.
Quantitative Real-Time PCR Total RNA was extracted from 30 to 50 embryos per group in Trizol (Roche) according to the manufacturer's instructions. RNA was reverse transcribed using the the PrimeScript RT reagent Kit with gDNA Eraser (Takara). Quanti cation of gene expression was performed in triplicates using Bio-rad iQ SYBR Green Supermix (Bio-rad) with detection on the Realplex system (Eppendorf). Relative gene expression quanti cation was based on the comparative threshold cycle method (2 -ΔΔCt) using ef1α as endogenous control gene. Primer sequences are given in Supplementary Table 1.

Qin X., Xia Y., Li P., Qu H., Liu Y., Yang Y., Lin J., Meng Z., Tian L., Wu Z., Huang S.S., Qin X., Zhou X., Chen S., Liu Y., Wang Y., Li X., Zeng H., Hákonarson H., & Zhuang J. (2020). Role of the ADCY9 gene in cardiac abnormalities of the Rubinstein-Taybi syndrome.

+ Open protocol

+ Expand

Embryonic RNA Extraction and Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

RNA was isolated from embryos (at least 20 embryos/sample) using the Qiagen RNeasy kit (74104). One microgram of purified RNA was used to generate cDNA using the Invitrogen Thermoscript RT-PCR kit (11146-024) and oligo-dT primers. cDNA was diluted 1:20 in nuclease-free water (Ambion). For analysis of the bad e2i2 morpholino, RT-PCR was performed and analyzed by standard agarose gel electrophoresis. For quantitative real-time PCR, three technical replicates were analyzed using an Eppendorf Realplex system. Primers were designed by Roche to be used with the Universal Probe Library. All primers used for RT-PCR and qPCR are listed in Table S1. GraphPad Prism software was used to plot the data, and error bars represent the standard error of averaged data. Statistical analyses were performed in GraphPad Prism using an unpaired student’s T test.

Toruno C., Carbonneau S., Stewart R.A, & Jette C. (2014). Interdependence of Bad and Puma during Ionizing-Radiation-Induced Apoptosis. PLoS ONE, 9(2), e88151.

+ Open protocol

+ Expand

Validation of Microarray Data by qRT-PCR

Check if the same lab product or an alternative is used in the 5 most similar protocols

The microarray data was validated by real-time quantitative RT-PCR. Total RNA (1 μg) was used for cDNA synthesis, using QuantiTect Reverse Transcription Kit (Qiagen) according to the manufacturer’s instructions.
PCR reactions were carried out using QuantiFast SYBR Green PCR Kit (Qiagen) according to the manufacturer’s protocol in an Eppendorf realplex system (Hamburg, Germany). Primer sequences are listed in Additional file 1. Thermal cycling conditions were as follows: 95 °C for 5 min followed by 40 cycles at 95 °C for 10 s and 60 °C for 30 s. The relative expression level for each gene was normalized to that of β-actin and reported as mean relative changes (± SD) compared with normal controls.

Yang Z., Wang L., Zhang F, & Li Z. (2015). Evaluating the antidiabetic effects of Chinese herbal medicine: Xiao-Ke-An in 3T3-L1 cells and KKAy mice using both conventional and holistic omics approaches. BMC Complementary and Alternative Medicine, 15, 272.

+ Open protocol

+ Expand

Quantification of eif1axb Expression in Zebrafish

Check if the same lab product or an alternative is used in the 5 most similar protocols

In zebrafish, total RNA was extracted from 30 to 50 embryos per group in trizol (Roche, Basel, Switzerland) according to the manufacturer’s instructions. RNA was reverse-transcribed using PrimeScript RT reagent kit with gDNA Eraser (Takara, Kusatsu, Japan). Quantification of the eif1axb gene expression was performed in triplicate using Bio-rad iQ SYBR Green Supermix (Bio-rad, Hercules, CA, USA) with detection on Real plex system (Eppendorf). Relative gene expression quantification was based on the comparative threshold cycle method (2^−ΔΔCt) and normalized with the reference ef1α gene [33 (link)].

Lian Z., Wu Z., Gu R., Wang Y., Wu C., Cheng Z., He M., Wang Y., Cheng Y, & Gu H.F. (2022). Evaluation of Cardiovascular Toxicity of Folic Acid and 6S-5-Methyltetrahydrofolate-Calcium in Early Embryonic Development. Cells, 11(24), 3946.

+ Open protocol

+ Expand

Quantitative Analysis of Immune Gene Expression

Check if the same lab product or an alternative is used in the 5 most similar protocols

Isolation of total RNA from cells after exposing them to experimental conditions was done using TRIzol reagent (Sigma). First strand cDNA (complementary DNA) synthesis was carried out using the Verso cDNA kit (Thermo Scientific). DNA contamination in the isolated RNA was eliminated using the RT enhancer available with the kit. Semi-quantitative PCR was carried out and amplified PCR products were resolved by 2% agarose gel electrophoresis. Quantitative real-time PCR analysis was performed in a real-plex system (Eppendorf) using the SYBR Green PCR Master mix (Thermo Scientific). Real-time PCR was carried out for IFN-γ, IL-10, IL-18, and β-actin using gene specific primers, as mentioned in Table 1. β-actin served as an internal control. Melting curve analysis was performed to confirm the specificity of amplified products, and delta CT method was used to quantify the alteration in gene expression.

Sharma V, & Kaur J. (2023). Acidic environment could modulate the interferon-γ expression: Implication on modulation of cancer and immune cells’ interactions. Asian Biomedicine: Research, Reviews and News, 17(2), 72-83.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!