Gotaq buffer

Manufactured by Promega

Sourced in United States

GoTaq buffer is a component of the GoTaq DNA Polymerase system offered by Promega. It provides the necessary reaction conditions for the DNA polymerase to perform DNA amplification during the polymerase chain reaction (PCR) process.

Automatically generated - may contain errors

Lab products found in correlation

Gotaq polymerase, by Promega (12 mentions) Gotaq dna polymerase, by Promega (6 mentions) Deoxynucleotide, by Promega (4 mentions) Clcbio genomics workbench, by Qiagen (2 mentions) Platinum taq, by Thermo Fisher Scientific (2 mentions) Dntp mix, by Promega (2 mentions) Cfx connect, by Bio-Rad (2 mentions) Deoxynucleotide triphosphates, by Meridian Bioscience (2 mentions) Gotaq polymerase, by Thermo Fisher Scientific (1 mentions) Simplysafe dye, by EURx (1 mentions) Dneasy blood and tissue kit, by Qiagen (1 mentions) Model 2720, by Thermo Fisher Scientific (1 mentions) Dneasy blood tissue kit, by Qiagen (1 mentions) Bigdye terminator v1, by Thermo Fisher Scientific (1 mentions) Abi 3130xl genetic analyzer, by Thermo Fisher Scientific (1 mentions) C57bl 6j mice, by Jackson ImmunoResearch (1 mentions) Encyclo, by Evrogen (1 mentions) Green gotaq buffer, by Promega (1 mentions) Taq dna polymerase, by Promega (1 mentions) Topo ta cloning kit, by Thermo Fisher Scientific (1 mentions)

Spelling variants of this product

GoTaq Flexi buffer (74 citations) GoTaq reaction buffer (22 citations) Green GoTaq Buffer (16 citations) Colorless GoTaq Flexi Buffer (14 citations) GoTaq® Green Flexi Reaction Buffer (4 citations) GoTaq Flexy Buffer (3 citations) GoTaq DNA polymerase and buffers (2 citations) Colorless GoTaq Flexi Reaction Buffer (2 citations) GoTaq Flexi Reaction Buffer (2 citations) GoTaq G2 Flexi Buffer (2 citations)

36 protocols using gotaq buffer

Cytochrome c Oxidase I Gene Amplification

Check if the same lab product or an alternative is used in the 5 most similar protocols

Genomic DNA was extracted from muscle tissues using the Qiagen DNeasy^® Blood and Tissue Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. After DNA extraction, a 655 base pairs (bp) length fragment within the cytochrome c oxidase subunit I gene (COI hereafter) was amplified by PCR from each sample. Each reaction contained 0.5 µM of forward and reverse COI-Fish primers [32 (link)], 0.25 mM dNTPs, 2.5 mM MgCl2, 1× Buffer GoTaq^® Promega, 0.15 µL of GoTaq^® Polymerase (5 µ/µL), 2 µL of DNA in a final volume of 20 µL. PCR products were run in a thermal cycler (Model 2720, Applied Biosystems, Foster City, CA, USA) with the following program: initial denaturation step at 95 °C for 5 min followed by 35 cycles of denaturation at 95 °C for 30 s, annealing at 57 °C for 30 s, elongation at 72 °C for 30 s, and a final extension at 72 °C for 15 min.
PCR results were visualised by electrophoresis in 2% agarose gel stained with 2.5 μL SimplySafe™ dye (EURX^®, Gdańsk, Poland). After amplicons purification, automated fluorescence sequencing was performed and both strands (forward and reverse) of each DNA fragment were sequenced.

Agyeman N.A., Blanco-Fernandez C., Steinhaussen S.L., Garcia-Vazquez E, & Machado-Schiaffino G. (2021). Illegal, Unreported, and Unregulated Fisheries Threatening Shark Conservation in African Waters Revealed from High Levels of Shark Mislabelling in Ghana. Genes, 12(7), 1002.

+ Open protocol

+ Expand

Merluccius Genus Mitochondrial DNA Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols

DNA was extracted with DNeasy Blood & Tissue kit by QIAGEN following the instructions of the manufacturer. The mitochondrial Control Region was chosen as molecular marker for its accuracy in species identification within the Merluccius genus (Machado-Schiaffino et al., 2008) (link). Primers MmerHk01 (5′-GGGGGGGCCGACAGAG TTATA-3′) and MmerHk02 (5′-CCCGCTAGACTTGCT TACTAA-3′) (Lundy et al., 2000) (link) were used to amplify a fragment of 450 bp within the Control Region. PCR amplification was performed using 10 pmol of each primer, 1.5 mM MgCl 2 , 0.25 mM dNTPs, 1x Buffer GoTaq ® Promega, 0.15 µl of GoTaq ® Polymerase (5U/µl) and 2 µL of the sample DNA in a final volume of 20 µl. PCR conditions were an initial denaturing step at 90°C for 5 min followed by 35 cycles with a 30" denaturation step at 95°C, annealing at 53°C for 30", and elongation step at 72°C for 45", plus a final elongation step of 15 min at 72°C. Amplicons were sequenced at Macrogen, Spain, using Sanger sequencing. The resulting sequences were edited using Lasergene Seqman software by DNASTAR.
All individuals sampled for this study were assigned to a species from the sequences using BLAST (Basic Tool Alignment Search Tool). BLAST results over 98% similarity identities were considered.

Blanco C.S., Erzini K., Rodriguez-Diego S., Alba-Gonzalez P., Thiam N., Sow F.N., Diallo M., Viðarsson J.R., Fernández-Vidal D., Gonçalves J.M., Rangel M., Stobberup K., García‐Vázquez E., & Machado‐Schiaffino G. (2022). Two Fish in a Pod. Mislabelling on Board Threatens Sustainability in Mixed Fisheries. Frontiers in Marine Science, 9.

+ Open protocol

+ Expand

Alu Screening in RP1 Exon 4

Check if the same lab product or an alternative is used in the 5 most similar protocols

In order to screen for the presence of the Alu element in exon 4 of RP1 distinct pair of primers were designed (forward: 5′-AGGCTTGTTTCCTAGGAGAGGT-3′, reverse: 5′-TTCTGCTTCTTTTTCACTTAGGC-3′) using the CLCbio Genomics Workbench (Qiagen, Hilden, Germany).
PCR amplification was performed in a 20 μl total volume containing 20 ng genomic DNA, 1× GoTaq buffer, 0.5 mM dNTPs, 10 μM of each primer, and 2 units (5 U/μl) of GoTaq polymerase (Promega, Madison, Wisconsin). PCR products were separated following agarose gel electrophoresis. PCR products displaying abnormal size profiles were purified (ExoSAP-IT, USB, Cleveland Ohio) and a sequencing reaction was performed in a total volume of 5 μl using 1 μl primer 3.3 µM, 0.5 μl BigDye Terminator v1.1, and 1 μl of the provided Buffer (Applied Biosystems, Foster City, California) Big Dye terminator cycle sequencing kit on an ABI 3130xl Genetic Analyzer (Applied Biosystems).
For this screening, we used 524 controls from the Tohoku University School of Medicine (N = 95) and the Yokohama City University Graduate School of Medicine (N = 429).

Nikopoulos K., Cisarova K., Quinodoz M., Koskiniemi-Kuendig H., Miyake N., Farinelli P., Rehman A.U., Khan M.I., Prunotto A., Akiyama M., Kamatani Y., Terao C., Miya F., Ikeda Y., Ueno S., Fuse N., Murakami A., Wada Y., Terasaki H., Sonoda K.H., Ishibashi T., Kubo M., Cremers F.P., Kutalik Z., Matsumoto N., Nishiguchi K.M., Nakazawa T, & Rivolta C. (2019). A frequent variant in the Japanese population determines quasi-Mendelian inheritance of rare retinal ciliopathy. Nature Communications, 10, 2884.

+ Open protocol

+ Expand

Virulence-associated gene (vtaA) PCR assay

Check if the same lab product or an alternative is used in the 5 most similar protocols

Leader sequences of the vtaA genes were aligned and compared for primer design, taking into account the clinical origin of the strains (strains isolated from either lesions or nasal cavities of healthy piglets). As forward primer, a common sequence within the leader sequence of vtaAs was identified (AAATATTTAGAGTTATTTGGAGTC) and named AV1-F. For specific amplification, two reverse primers were chosen; V1-R (AATATACCTAGTAATACTAGACTTAAAAG), for vtaA found in clinical (putative virulent) strains, and NV1-R (CAGAATAAGCAAAATCAGC), for non-clinical nasal (putative non-virulent) strains. Conditions for the PCR reactions were, 1.5 mM MgCl₂, 0.4 mM each deoxynucleotide triphosphate (dNTP), 400 nM each primer, 1 U GoTaq polymerase (Promega) and 0.3–500 ng of genomic DNA in a final volume of 25 μL in GoTaq buffer (Promega). Cycling conditions were 5 min at 94 °C, followed by 30 cycles of 45 s at 94 °C, 45 s at 52 °C and 1 min at 72 °C, then a final incubation at 72 °C for 7 min.

Galofré-Milà N., Correa-Fiz F., Lacouture S., Gottschalk M., Strutzberg-Minder K., Bensaid A., Pina-Pedrero S, & Aragon V. (2017). A robust PCR for the differentiation of potential virulent strains of Haemophilus parasuis. BMC Veterinary Research, 13, 124.

+ Open protocol

+ Expand

Genotyping Estrogen Receptor Alpha Knockout Mice

Check if the same lab product or an alternative is used in the 5 most similar protocols

ERα heterogeneous (ERα^+/−) C57BL/6J mice ordered from the Jackson Laboratory were bred at the age of 2 months to obtain complete ERα knock-out mice (ERα^−/−). Pups were genotyped within 9 days of birth. Genotypes were determined by PCR of genomic DNA from finger or toe clippings. Clippings were heated at 95°C for 45 min in 50 mM NaOH and neutralized with equal volume of 1 M Tris, pH 6.8. One μL of this DNA solution was added to 19 μL of the following: 0.25 mM of primers for the ERα gene, 1X GoTaq Buffer (Promega, Madison, WI), 0.2 mM each deoxynucleotide (Promega) and 8 U Platinum Taq (Life Technologies). PCR was performed for 30 cycles as follows: 95°C for 3 min, denaturation at 95°C for 30 s, annealing at 58°C for 30 s (ERα^−/− PCR1) or 51°C for 30 s (ERα^−/− PCR2), and elongation at 72°C for 1 min. PCR products were separated electrophoretically on an ethidium bromide-containing 2% agarose gel and visualized under UV illumination (18 ).

Chanana V., Hackett M., Deveci N., Aycan N., Ozaydin B., Cagatay N.S., Hanalioglu D., Kintner D.B., Corcoran K., Yapici S., Camci F., Eickhoff J., Frick K.M., Ferrazano P., Levine J.E, & Cengiz P. (2023). TrkB-mediated sustained neuroprotection is sex-specific and ERα dependent in adult mice following neonatal hypoxia ischemia. Research Square.

+ Open protocol

+ Expand

Genetic Markers Distinguish Arabis Species

Check if the same lab product or an alternative is used in the 5 most similar protocols

Based on the genomic information available (Willing et al. 2015; Kiefer et al. in preparation), length polymorphism markers distributed across the complete genomes were designed to distinguish A. alpina and A. montbretiana. To confirm the cross of A. montbretiana × A. alpina and initial genotyping of the subsequent generations, 40 length polymorphism markers were used (Table S8, Supporting information). For genotyping the introgression lines further, 84 markers were employed (Table S8, Supporting information). Length polymorphism markers were amplified in multiplexing PCRs containing two to three primer pairs (2 μL GoTaq buffer (Promega, Wisconsin, USA), 2 μL template, 1 μL MgCl₂ (25 mm), 0.4 μL dNTPs (10 mm), 0.4 μL of each primer pair (each primer 10 μm), 0.05 μL GoTaq (Promega, Wisconsin, USA), 3.35 μL water), separated on 3% agarose gels (TAE) and scored as heterozygous or homozygous for either parent. Arabis alpina and A. montbretiana were used as control. All primers were designed using the program primer3 (Rozen & Skaletsky 2000). For the introgression lines, genotypes were plotted using the program flapjack 1.016.03.04 (Milne et al. 2010).

Kiefer C., Severing E., Karl R., Bergonzi S., Koch M., Tresch A, & Coupland G. (2017). Divergence of annual and perennial species in the Brassicaceae and the contribution of cis‐acting variation at FLC orthologues. Molecular Ecology, 26(13), 3437-3457.

+ Open protocol

+ Expand

Comparison of SD and Bst DNA Polymerase in LAMP

Check if the same lab product or an alternative is used in the 5 most similar protocols

Example 2

Comparison of Strand Displacement Activity and Thermostability of SD DNA Polymerase with Bst Large Fragment DNA Polymerase in LAMP Reaction

Displacement activity and thermostability of SD and Bst DNA polymerase were compared in LAMP reaction.

LAMP amplification was performed with control template DNA and primers for Group B Streptococcus (GBS) from Meridian Bioscience Inc. (http://www.meridianbioscience.com)

SD and Bst DNA polymerase (NEB) were compared in two reactions buffers: GoTaq buffer (Promega) and Encyclo (Evrogen, www.evrogen.com). Reaction mixtures (50 μl) contained: 50 units of DNA polymerase (SD or Bst), 3.5 mM MgCl2, 0.5 mM dNTP (each), 2 μl GBS control template DNA, and GBS primers: F3T3—0.2 μM, B3—0.2 μM, FIP—0.8 μM, BIP—0.8 μM, FL—0.8 μM, BL—0.8 μM.

LAMP reactions were performed at 63° C. for 45 min, with or without initial preheating at 92° C. for 2 min.

The results are shown in FIG. 1, and indicate that the mutant enzyme of the invention (SD polymerase) demonstrates in the LAMP reaction a similar with Bst strand displacement activity and the efficiency of DNA, but SD polymerase has much higher thermostability than Bst polymerase.

US09896671B2. DNA polymerases (2018-02-20). BIORON GmbH [DE], None [RU], None [RU]. Inventors: Konstantin Ignatov [RU], Vladimir Kramarov [RU].

+ Open protocol

+ Expand

Genomic Amplification and Sequencing of WNT10B

Check if the same lab product or an alternative is used in the 5 most similar protocols

All WNT10B^R and ht-WNT10B genomic amplifications were performed using the reaction mixture of 50 μl consisted in 500 ng of DNA, 1× GoTaq Buffer, 1.5 mM MgCl₂, 0.2 μM of P2, P1 and P5 primers listed in Extedended Table 4, 0.5 mM of dNTPs and 1U of TaqDNA Polymerase (Promega, Madison, WI, USA). Total RNA was extracted and reverse transcribed using the protocol previous described and PCRs were performed in a final volume of 50 μl containing 5 μl of DNA as template, 5X Green GoTaq Buffer (Promega Corporation, Madison, WI, USA), 4 mM of MgCl₂, 0.2 μM of each primer, 0.2 mM dNTPs (Promega), 0.5 U of Taq DNA polymerase (5 U/μl; Promega). The amplifications were performed with following thermal conditions: P2-P1, 94 °C for 3 min, 30 cycles at 94° for 30 s, 58 °C for 30 s, 72 °C for 30 s and 72 °C for 5 min; P2-P10, 94 °C for 5 min, 33 cycles at 94° for 30 s, 59 °C for 45 s, 72 °C for 5 min and 72 °C for 10 min. Then the PCR products were visualized by 0.8% and 1.5% electrophoresis agarose gels and sequenced using the chemistry described above. The obtained P2-P10 fragment was gel purified and cloned into TOPO® TA Cloning® Kit (Invitrogen, Carlsbad, CA). We amplified GAPDH as housekeeping gene, following the protocol described above.

Lazzaroni F., Del Giacco L., Biasci D., Turrini M., Prosperi L., Brusamolino R., Cairoli R, & Beghini A. (2016). Intronless WNT10B-short variant underlies new recurrent allele-specific rearrangement in acute myeloid leukaemia. Scientific Reports, 6, 37201.

+ Open protocol

+ Expand

Multiplex PCR Detection of Shiga Toxin Genes

Check if the same lab product or an alternative is used in the 5 most similar protocols

Detection of the genes encoding Shiga toxin 1 (stx1) and Shiga toxin 2 (stx2) in nucleotide sequence of phage was performed by multiplex PCR as previously described by Paton and Paton (2002 (link)). Amplification was performed with a CFX96 PCR system (Bio-Rad laboratories, Inc., USA) using a GoTaq® PCR Core System I (Promega, USA) in a total volume of 25 μL containing each dNTP at 100 μM, 1.5 mM MgCl₂, 10 pmol of each primer, 5 × GoTaqBuffer, and 1 U GoTaq polymerase (Promega, USA) according to the manufacturer's instructions. One microliter of purified phage DNA was used as templates in PCR assays. As an internal positive control of PCR, E. coli O157:H7 CECT 4076 DNA was included in the assays. Two microliters of each PCR product was analyzed by agarose (0.8%) gel electrophoresis, and bands were viewed by ethidium bromide staining. The primers set used in the PCR assays were commercially custom-synthesized by Sigma-Aldrich (Toluca, Mexico).

Amarillas L., Rubí-Rangel L., Chaidez C., González-Robles A., Lightbourn-Rojas L, & León-Félix J. (2017). Isolation and Characterization of phiLLS, a Novel Phage with Potential Biocontrol Agent against Multidrug-Resistant Escherichia coli. Frontiers in Microbiology, 8, 1355.

+ Open protocol

+ Expand

Constructing Dual-Labeled DNA Fragments

Check if the same lab product or an alternative is used in the 5 most similar protocols

Making a DNA construct dual-labeled at our desired positions was an engineering challenge because a one-step PCR reaction would require an internally labeled DNA oligo to be longer than 100 bases. Such DNA oligos were not produced by IDT at the time. (Nowadays it can be purchased as an Ultramer.) To overcome this challenge, a shorter dual-labeled DNA was made by PCR, restriction digested to produce a sticky overhang, and then ligated with a biotinylated DNA fragment to form the complete construct. Briefly, perform a 2.4 mL PCR reaction using GoTaq Buffer (Promega M7921), 200 μM dNTPs, 1 μM forward primer, 1 μM reverse primer, 100 ng or less template DNA and 24 μL Taq DNA polymerase (NEB M0273L). Purify and concentrate the PCR DNA product by ethanol precipitation. Digest the DNA with DraIII-HF restriction enzyme (NEB R3510L) for 3 hr at 37°C. Purify the digested DNA product by anion exchange chromatography (Cytiva 17115301) on an FPLC instrument, followed by ethanol precipitating DNA from the peak fractions. Simultaneously prepare the biotinylated DNA fragment by annealing two single-stranded DNA oligos. Ligate the Cy5 Cy7 dual-labeled DNA with the biotinylated fragment using T4 DNA ligase (Thermo Fisher EL0011) and purify the ligated DNA by agarose gel extraction or FPLC in case of a large-scale production.

Feng X.A., Ness K.M., Liu C., Ahmed I., Bowman G.D., Ha T, & Wu C. (2023). GAGA Factor Overcomes 1D Diffusion Barrier by 3D Diffusion in Search of Nucleosomal Targets. bioRxiv.

+ Open protocol

+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Revolutionizing how scientists
search and build protocols!