Equal amounts of RNA of the biological replicates were pooled, and 6.0 ng total RNA were used as starting material for library preparation using the NEBNext Multiplex Small RNA Library Prep Set for Illumina (New England Biolabs, USA) in accordance with the manufacturer's instructions. After a pre-amplification, PCR products were purified by applying the Monarch PCR Cleanup Kit (New England Biolabs). Then, cDNA libraries were evaluated via capillary gel electrophoresis using the DNA 1000 Kit and the Bioanalyzer 2100 (Agilent Technologies) according to the manual. A miRNA-specific length of 130–150 base pairs of barcoded cDNA libraries was selected by applying and fractionating 5 ng of pooled cDNA on a 4% agarose gel (MetaPhor, USA). Clean-up of cut gel slices at the appropriate size range was performed using the Monarch Gel Extraction Kit (New England Biolabs) and correct size and molarity were analyzed via capillary gel electrophoresis using the Bioanalyzer DNA High Sensitivity Kit (Agilent Technologies). Finally, 50 cycles of single-end sequencing-by-synthesis reactions were conducted on the HiSeq 2500 instrument (Illumina, USA) with the HiSeq Rapid SBS Kit v2 (Illumina, USA).
Monarch pcr cleanup kit
Manufactured by New England Biolabs
The Monarch PCR Cleanup Kit is a laboratory product designed to purify DNA fragments from PCR reactions. It provides a simple and efficient method to remove unwanted reagents, primers, and other contaminants from PCR samples.
Automatically generated - may contain errors
Lab products found in correlation
Chemidoc xr, by Bio-Rad (2 mentions)
Q5 hot start high fidelity polymerase, by New England Biolabs (2 mentions)
Nebnext blunt end repair kit, by New England Biolabs (2 mentions)
Phusion dna polymerase, by New England Biolabs (2 mentions)
Hiseq 2500 instrument, by Illumina (1 mentions)
Nebnext multiplex small rna library prep set for, by Illumina (1 mentions)
Bioanalyzer high sensitivity dna kit, by Agilent Technologies (1 mentions)
Monarch gel extraction kit, by New England Biolabs (1 mentions)
Hiseq rapid sbs kit v2, by Illumina (1 mentions)
2100 bioanalyzer, by Agilent Technologies (1 mentions)
Dna 1000 kit, by Agilent Technologies (1 mentions)
Pspxi, by New England Biolabs (1 mentions)
Pspxi, by Thermo Fisher Scientific (1 mentions)
Vaccinia capping system kit, by New England Biolabs (1 mentions)
Mmessage mmachine t7 ultra kit, by Thermo Fisher Scientific (1 mentions)
Hiscribe t7 quick high yield rna synthesis kit, by New England Biolabs (1 mentions)
Nebnext da tailing kit, by New England Biolabs (1 mentions)
Ampure xp bead, by Beckman Coulter (1 mentions)
S220 focused ultrasonicator, by Covaris (1 mentions)
Accustart 2 pcr supermix, by Quantabio (1 mentions)
10 protocols using monarch pcr cleanup kit
1
Small RNA Library Preparation and Sequencing
2
Optimizing Viral Transduction of hOPCs
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
EF1α:GCaMP6s was described previously12 (link). EF1α:jRCaMP1a was cloned as follows. pGP-CMV-NES-jRCaMP1a was obtained from AddGene (#61562)35 (link). The nuclear export signal (NES) and jRCaMP1a coding region was PCR amplified: SpeI, forward-5′ AAAACTAGTGAACCGTCAGATCCGCTAG-3′; PspXI (Thermo Fisher Scientific), reverse, 5′-AAAGCTCGAGCTCTACAAATGTGGTATGGCTG-3′ (Thermo Fisher Scientific). PCR products were purified (Monarch PCR Cleanup Kit (NEB, #T1030S)) and restriction digested with unique 5′ SpeI and 3′ PspXI sites, and purified again. NES-jRCaMP1a digested PCR fragments were then ligated into lentiviral pTRIP-EF1α vector (a gift of Abdel Benraiss, University of Rochester)36 (link). The plasmid pLenti-EF1α-OptoSTIM was a gift from Taeyoon Kyung (KAIST, DAEJEON, Republic of Korea)37 (link). Lentiviruses were generated as described38 (link) and titration of EF1α:GCaMP6s and EF1α:OptoSTIM was performed as previously described39 (link). Optimized multiplicity of infection (MOI) in hOPCs was determined for EF1α:GCaMP6s and EF1α:jRCaMP1a by infecting hOPCs and quantifying proportion of responsive cells following administration of 25 µM Oxo-M. Optimal MOI for EF1α:OptoSTIM lentivirus was determined through analysis of optimal GFP expression in infected hOPCs.
3
Capped and Uncapped mRNA Production
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
For IVT, the different plasmids were linearized with the type IIS restriction enzyme BspQI and purified with the Monarch PCR & Cleanup Kit (NEB). Capped or uncapped mRNAs were produced with the T7 ULTRA mMESSAGE mMACHINE Kit (Ambion, Life Technologies, France) or the HiScribe T7 Quick High Yield RNA Synthesis Kit (NEB), respectively. The reactions were done according to the manufacturer’s recommendations. Then, the IVT mRNAs were precipitated with LiCl and their integrity evaluated by agarose gel electrophoresis. The enzymatic mRNA capping was performed with the Vaccinia Capping System Kit (NEB) according to the manufacturer’s recommendations. Vaccinia virus-capped mRNAs were precipitated by adding 1 volume of isopropanol 100% and 0.1 volume of 3 M sodium acetate, pH 5.5. After 30 min at −20°C, the RNA solution was centrifuged (19,000 × g, 4°C, 45 min) and the pellet resuspended in nuclease-free water. The enzymatic capping efficiency was validated by fluorescence microscopy after mRNA transfection into HeLa cells.
4
Profiling TREM2 Splicing in Anterior Cingulate
5
Transposon-enriched Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA (2 μg) was resuspended in 50 μL distilled water and sheared to approximately 550-bp fragments using an S220 focused ultrasonicator (Covaris) according to the manufacturer’s protocol. Fragmented DNA was repaired using NEBNext blunt-end repair kit (New England Biolabs) and purified using Monarch PCR cleanup kit (NEB). Blunted DNA was A-tailed using NEBNext dA-tailing kit (NEB) and column purified. Custom transposon sequencing adaptors (Table S4) were generated by heating an equimolar mix of Com_AdaptorPt1 primer and Com_AdaptorPt2 (P7+index) primers to 95°C for 5 min, followed by cooling by 1°C every 40 s to a final temperature of 4°C in a thermocycler. Adaptors were ligated to A-tailed library fragments using NEBNext quick ligase kit. Transposon-containing fragments were enriched by PCR using the ComP7 primer (10 μM) and an equimolar mix of primers P5-IR2a-d primer (10 μM) in a reaction with 50 ng of adaptor-ligated template and Phusion DNA polymerase (NEB) in a thermocycler with the following program: 98°C for 3 min; 4 cycles of 98°C for 20 s, 70°C 20 for s, and 72°C for 1 min; 20 cycles of 98°C for 20 s, 67°C for 20 s, and 72°C for 1 min; and 72°C for 3 min. Transposon-enriched libraries were subsequently purified with AMPure XP beads (Beckman), pooled, and further purified using AMPure XP beads.
6
Plant DNA Extraction and Molecular Identification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
DNA was isolated from 40 to 100 mg fresh leaves (Actinidia species) or 20 to 80 mg wood chips (Lonicera species) using Omega Bio-Tek’s E.Z.N.A. Plant DNA kit (#D2411-00) as per manufacturer’s instructions. matK was amplified with AccuStart II PCR SuperMix (QuantaBio #89235-018) and primers 5′–CGTACAGTACTTTTGTGTTTACGAG–3′ and 5′–ACCCAGTCCATCTGGAAATCTTGGTTC–3′ (250 nM final concentration) [50 (link)] using the following program: 3 min at 95 °C, 40× (30 s at 95 °C, 40 s at 60 °C, 60 s at 72 °C), and 5 min. at 72 °C. rbcL was amplified with AccuStart II and primers 5′–ATGTCACCACAAACAGAAAC–3′ and 5′–TCGCATGTACCTGCAGTAGC–3′ [50 (link)] using the following program: 1 min. at 94 °C, 35× (10 s at 94 °C, 20 s at 60 °C, 45 s at 70 °C). The psbA – trnH intergenic spacer was amplified using primers 5′–GTTATGCATGAACGTAATGCTC–3′ and 5′–CGCGCATGGTGGATTCACAATCC–3′ [51 (link)] as described for rbcL. After DNA cleanup using NEB’s Monarch PCR Cleanup kit (#T1030G), the amplicons of approximately 450–800 bp were Sanger sequenced using the forward and reverse primer. T-Coffee [52 (link)] was used to align the sequences and the consensus sequence was used to identify the species using NIH’s nucleotide BLAST.
7
Sequencing of NtrC Pathway Mutants
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Second-step mutations targeting the ntr pathway were identified through PCR amplification and sequencing of the ntrC helix-turn-helix domain using primer sequences: 5′-GGATGGCGAGTTCTATCGGG-3 and 5′-CGGTTCATGGTGCATTGAAGC-3′. Samples were prepared using a Monarch® PCR Cleanup kit (NEB) and Sanger sequencing was performed by Eurofins Genomics. If two genotypes were taken from the same motile plate and were observed to have the same mutation in ntrC, these were deemed to have arisen from the same sub-population and treated as one isolate. Following initial phenotyping, a smaller subset of mutants showcasing weak, median, and strong motility from genomic backgrounds ntrB A289C, glnK A5C, glnK 5886 del., ntrC C251A and glnA T169A (no median mutant sent for glnA) were sent for Illumina whole-genome sequencing (WGS). Genome resequencing was performed by SeqCenter, and single-nucleotide variants and small indels were called using Snippy with default parameters [21 ], using P. fluorescens SBW25 genome as an assembly template (NCBI Assembly: ASM922v1, GenBank sequence: AM181176.4). This analysis was performed through the Cloud Infrastructure for Microbial Bioinformatics (CLIMB) [22 (link)].
8
Transposon DNA Library Preparation
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Two μg of extracted DNA libraries were resuspended in purified water and sheared to approximately 550 bp fragments using a S220 focussed-ultrasonicator (Covaris), according to the manufacturer's protocol. Sheared DNA was repaired using NEBNext blunt-end repair kit (New England Biolabs) and purified using Monarch PCR clean-up kit (New England Biolabs). Blunted DNA was A-tailed using NEBNext dA-tailing kit and column-purified. Custom transposon sequencing adaptors, or “TraDIS tags,” (Table 2 ) were generated by heating an equimolar mix of adaptor standard primer and adaptor P7+index to 95°C for 7 mins and then allowed to cool to room temperature. Adaptors were ligated to A-tailed library fragments using NEBNext quick ligase kit. Transposon-containing fragments were enriched by PCR using ComP7 primers ComP5 using Phusion DNA polymerase (New England Biolabs) in a 20-cycle reaction. Library fragments were subsequently cleaned up with AMPureXP purification beads (Beckman).
9
RT-PCR Amplification and Phosphorothioate Strand Purification
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA extracted from infected MAD6 cell cultures (kindly provided by Drs. Isabel Sola and Sonia Zúñiga) or patient samples were amplified by RT-PCR using the SuperScript™ III One-Step RT-PCR System with Platinum™ Taq DNA Polymerase (Invitrogen). Briefly, several individual reactions (50 μL each) were prepared according to the manufacturer's instructions with the following modifications: total RNA (20 ng) as template, 1 μM forward primer (the first 6 nucleotides at the 5′ end contain phosphorothioate bond modifications), 1.2 μM reverse primer (Table S4 ), and 2 mM MgSO4. The cycling parameters were adjusted to the specific amplified region and are summarized in Table S4 . Amplified RT-PCR products for the same target region were pooled together and loaded in a 3% agarose gel to check the success of the reaction. dsDNA products were treated with 0.4 U of T7 exonuclease (New England Biolabs; Cat. Nº M0263L) per μL of RT-PCR reaction during 45 min at 37 °C followed by 10 min at 80 °C to digest the unprotected (non-phosphorothioated) strand. Finally, when needed, ssDNA was purified employing Monarch PCR & Cleanup Kit (New England Biolabs; Cat. Nº #T1030). The purified ssDNA product was resuspended in PCR-grade water and used as target in detection experiments as described previously.
10
TREM2 Exon Amplification and Sequencing
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The cDNA samples from the anterior cingulate samples were amplified using primers corresponding to TREM2 exon 1 (5'-CCTGACATGCCTGATCCTCT-3') and exon 5 (5'-GTGTTCTTACCACCTCCCC-3') with Q5 high-fidelity hot-start polymerase (NEB # M0493L).
Thermocylcing parameters were as follows: 98°C 30 s; 98°C 5 s, 67°C 5 s, 72°C 45 s, 30 cycles; 72°C 2 min, 25°C hold. PCR products were separated on a 8% acrylamide gel and imaged using a BioRad ChemiDoc XR. Bands were extracted for subsequent amplification as above and purification using a Monarch PCR Cleanup Kit (NEB T1030L). Purified products were sequenced commercially (ACGT; Wheeling, IL) and compared to the reference transcript NM_018965.4 to determine splicing.
Thermocylcing parameters were as follows: 98°C 30 s; 98°C 5 s, 67°C 5 s, 72°C 45 s, 30 cycles; 72°C 2 min, 25°C hold. PCR products were separated on a 8% acrylamide gel and imaged using a BioRad ChemiDoc XR. Bands were extracted for subsequent amplification as above and purification using a Monarch PCR Cleanup Kit (NEB T1030L). Purified products were sequenced commercially (ACGT; Wheeling, IL) and compared to the reference transcript NM_018965.4 to determine splicing.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!