Ksf medium

As model for benign pancreatic ductal epithelium, the human pancreatic ductal epithelial cell line H6c7-pBp and as model for premalignant pancreatic ductal epithelium harboring a kras^G12V mutation, the cell line H6c7-kras [28 (link)] were used, both well-established cell models and kindly provided by M.S. Tsao (Ontario Cancer Institute, Toronto, Canada). Both cell lines were cultured in H6c7-medium (50 % RPMI 1640 medium (Biochrom, Berlin, Germany) and 50 % KSF-medium (Gibco Life Technologies, Darmstadt, Germany) supplemented with 5 % fetal calf serum, 0.5 % L-glutamine (both Biochrom), 50 μg/mL bovine pituitary extract, 5 ng/mL epidermal growth factor (both Gibco Life Technologies) + 0.5 μg/mL puromycin (Invitrogen, Darmstadt, Germany). The human pancreatic ductal epithelial cell line Colo357 was kindly provided by H. Kalthoff, Institute of Experimental Cancer Research, Kiel, Germany) and kept in Colo357-medium which is composed of RPMI-1640 medium supplemented with 1 % L-glutamine, 10 % FCS and 1 % sodium pyruvate. Colo357 cells used in this study harbor a wild type Smad4/DPC4 genotype [29 (link)] and are genetically distinct from those Colo357 cells having a homozygous deletion of the Smad4 gene [30 (link)].

The ccRCC cell lines (i.e., ACHN and 786-O) were purchased from the Institute of Biochemistry and Cell Biology (Shanghai, China). The HK-2 human kidney tubular epithelial cell line was purchased from the American Type Culture Collextios (Manassas, VA, USA). ACHN cells were cultured in Eagle's Minimum Essential Medium supplemented with 10% fetal bovine serum (FBS). The 786-O cells were cultured in RPMI-1640 medium supplemented with 10% FBS (Gibco; Thermo Fisher, Waltham, MA, USA). The HK-2 cells were cultured in KSF medium (Gibco; Thermo Fisher, Waltham, MA, USA) containing epidermal growth factor (PeproTech, Rocky Hill, NJ, USA). All cells were cultured at 37°C in a humidified incubator with 5% CO₂.

HCET cells (HCE-2 [50.B1], ATCC, Gaithersburg, MA) were cultured in Keratinocyte-serum free (KSF) medium (Gibco, Grand Island, NY) with 5ng/ml human recombinant EGF, 0.05mg/ml bovine pituitary extract, 0.005mg/ml insulin, and 500ng/ml hydrocortisone as previously described (Somayajulu et al., 2023 (link)). Cells were treated with PM₁₀ (0, 25, 50, 100, 200, 500, 800 and 1200µg/ml for 24h for the MTT assay. For all other experiments, cells were incubated with 100μg/ml (per cell viability data from dose curve; 75-80% viability) PM₁₀ at 37°C and 5% CO₂ for 24hr. To investigate the combined effects of PM₁₀ on P. aeruginosa infected cells, a subset of cells were challenged with strain 19660 at a multiplicity of infection (MOI) of 20 for 3h. To assess the effects of SKQ1 (BOC Sciences, Shirley, NY, USA), another subset of cells were incubated with 50nM SKQ1, 1h before PM₁₀ exposure (Somayajulu et al., 2023 (link)) and then challenged with strain19660 at similar MOI. Another group of HCET were challenged with strain 19660 at a MOI of 20 for 3h to assess the effects of bacteria alone on these cells. Phase contrast microscopy was used to photograph cell preparations using a Leica EL 6000 microscope (Deerfield, IL, USA). All the images were acquired at the same magnification and processed similarly.

The production of candidalysin-V5 by the various strains was detected by dot immunoblotting. C. albicans cells from YPD overnight culture were washed three times with PBS buffer and then inoculated into KSF medium (#37010022, Gibco,) at a concentration of 2x10⁷ cells/ml. After 7 hours of growing in a 37°C shaker, the culture supernatants were clarified twice by centrifugation at 3500g for 5 min. Culture supernatants were then passed through low protein binding 0.45μm PVDF filters to further remove any debris. The proteins in the supernatants were precipitated with 20% trichloracetic acid at 4°C overnight and collected by centrifugation at 15000g for 5 min. The pellets were washed twice with 100% ice-cold acetone and then dried at 90°C. For dot blotting, the dried proteins were suspended in SDS loading buffer and boiled for 10 min, after which serial 2-fold dilutions were spotted onto a 0.45μm PVDF transfer membrane for blotting. After blocking the membrane with 5% fat-free milk in TBST (0.05% Tween 20), it was incubated with mouse anti-V5 monoclonal antibody (#R960-25, ThermoFisher) in 5% fat-free milk in TBST, rinsed three times and then incubated with a HRP-labeled goat anti-mouse IgG secondary antibody-HRP (Invitrogen, #G21040). The spots were visualized by enhanced chemiluminescence (#AC2103, Azure Biosystems,).

Human NPC cell lines (CNE2, SUNE1, HONE1, and 5-8F) were cultured in RPMI-1640 (Invitrogen, USA) supplemented with 5% FBS (Gibco). Cisplatin resistant cell lines, 5-8F/DDP and CNE2/DDP, were established by long-term culture in increasing concentrations of DDP, up to 2.5 μg/ml, for more than 6 months. The normal human nasopharyngeal epithelial cell line, NP69, was grown in KSF medium (Invitrogen) supplemented with bovine pituitary extract (BD Biosciences, San Jose, CA). All nasopharyngeal epithelial cell lines and NPC cell lines were generously provided by Professor Musheng Zeng (Sun Yat-sen University Cancer Center, China).

Total RNA was extracted from NP69, HNE1, HONE1, and 6‐10B cultured cells by RNAiso Plus (Takara, China). All cell lines were a gift from Musheng Zeng (Cancer Center of Sun Yat‐sen University). NP69 cells grown in keratinocyte/serum‐free (KSF) medium (Invitrogen). HNE1, HONE1, and 6‐10B cells were grown in RPMI‐1640 medium (GIBCO) supplemented with 5% (vol/vol) fetal bovine serum (FBS, GIBCO). All cells were cultured in an incubator at 37°C with humidified 5% (vol/vol)CO₂. The cDNA was used as the template with SYBR Green PCR Master Mix, and in triplicate subjected to PCR. An average Ct value from the triplicate assays was used for further calculations, and all the samples were normalized to the signal generated by GAPDH.
The primer sequences were as follows:

hsa_circ_0002354:F,5′‐ATGAATGGCTGCGAGAAGGA‐3′

hsa_circ_0002354:R,5′‐TAGTGGAATAGGCCCTGGGAA‐3′

hsa_circ_0055854:F,5′‐GAAAGGTGATGCAGAGCCAG‐3′

hsa_circ_0055854:R,5′‐GCAGAAAGTGGTGGAAGCC‐3′

GAPDH: F,5′‐AGAAGGCTGGGGCTCATTTG‐3′;

GAPDH: R,5′‐GCAGGAGGCATTGCTGATGAT‐3′.

The relative expression levels were determined by the 2^−△△Ct method.