qPCR was performed to quantify the relative Ochsp70 expression levels in different tissues, including female and male, mating and unmating, and after double-stranded RNA (dsRNA) treatments. For this purpose, the ABI 7500 PCR detection system (Applied Biosystems, United States) was used. RPL19 was used as reference gene, as described by Zhang et al. (2020).
Abi 7500 pcr detection system
Manufactured by Thermo Fisher Scientific
Sourced in United States
The ABI 7500 PCR Detection System is a real-time PCR instrument designed for versatile and accurate gene expression analysis. It provides reliable detection and quantification of nucleic acid targets, supporting a range of applications including gene expression profiling, pathogen detection, and SNP genotyping.
Automatically generated - may contain errors
Lab products found in correlation
Nanodrop 1000 spectrophotometer, by Thermo Fisher Scientific (2 mentions)
Hieff qpcr sybr green master mix low rox, by Yeasen (1 mentions)
Primescript rt master mix, by Takara Bio (1 mentions)
Tb green premix ex taq 2, by Takara Bio (1 mentions)
Prism 7, by GraphPad (1 mentions)
Trizol reagent, by Thermo Fisher Scientific (1 mentions)
Sybr green master mix, by Thermo Fisher Scientific (1 mentions)
Revertaid rt reverse transcription kit, by Thermo Fisher Scientific (1 mentions)
Rnaiso plus kit, by Takara Bio (1 mentions)
Sybr green 1, by Roche (1 mentions)
6 protocols using abi 7500 pcr detection system
1
Quantifying Ochsp70 Expression in Tissues
2
RT-qPCR Assay for Transcript Quantification in Tuta absoluta
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Relative standard curves for the transcripts were generated with 2-fold serial dilutions of cDNA (1/2, 1/4, 1/8, 1/16, 1/32, and 1/64) extracted from the second instar larvae of T. absoluta. The corresponding RT-qPCR efficiencies (E) were determined for each gene and calculated according to the following equation: E = (10[−1/slope] − 1) × 100 [49 (link)]. RT-qPCR was performed on the ABI 7500 PCR Detection System (Applied Biosystems, Waltham, MA, USA). The RT-qPCR reactions consisted of 10 µL Hieff® qPCR SYBR® Green Master Mix (Low Rox) (Yeasen Biotech Co., Ltd., Shanghai, China), 0.4 µL each forward and reverse primers (10 µM), and 1 µL the cDNA template. Thermal cycling conditions were as follows: an initial cycle at 95 °C (30 s), followed by 40 cycles of 10 s at 95 °C and 30 s at 60 °C. After all reactions, a melting curve analysis from 65 to 95 °C was used to ensure the consistency and specificity of the amplified product. According to the results of the standard curve, the cDNA template of all samples was diluted 5 times in the reference gene expression experiment. Each treatment included five biological replicates, and each reaction was performed in triplicate.
3
Quantitative Analysis of Icos mRNA in Rat Aorta
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from rat aortas with the RNeasy Fiber Tissue Mini Kit (QIAGEN, Item No. 74704), a special RNA extraction kit designed for high fiber tissues. The genomic DNA was digested and the RNA was reverse transcribed into cDNA with the PrimeScript™ RT Master Mix (Takara, cat: RR036A). All real-time PCR reactions were performed with the ABI 7500 PCR detection system (Applied Biosystems; Thermo Fisher Scientific, Inc., USA) using the TB Green® Premix Ex Taq™ II (Takara, cat: RR820A). The following primers were used: Rat GAPDH forward, ATGACTCTACCCACGGCAAG, and reverse, ACTGTGGTCATGAGCCCTTC; rat ICOS forward, CTACTTCTCGTGCGTCTT, and reverse, GCTTCCCTTGGTCTTG. The relative expression of Icos mRNA was calculated using the ΔΔCt method, and statistical analysis was performed using Prism7 (GraphPad Software, Inc., USA).
4
Quantification of HO-1 mRNA Expression
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Total RNA was extracted from the cortical brain using the TRIzol® reagent (Invitrogen Life Technologies, Carlsbad, CA, USA). Total RNA (3 μg) was reverse transcribed to cDNA using the Rever Tra Ace-a First-strand cDNA Synthesis Kit (Toyobo Life Sciences, Osaka, Japan). The resulting cDNA was incubated with the SYBR Green Master Mix (Applied Biosystems, Foster City, CA, USA) and primers for HO-1 or β-actin (each at 150 nM final concentration).
For quantitative analysis, we performed 40 amplification cycles (denaturation: 95ºC, 15 s; annealing: 60°C, 30 s; elongation: 72°C, 35 s) on an ABI 7500 PCR Detection System (Applied Biosystems, USA). Melting curve and sequencing data were used to confirm the specificity of the PCR products. HO-1 mRNA levels were normalized to those of β-actin and subsequently expressed as values relative to the control using the comparative threshold cycle method.
For quantitative analysis, we performed 40 amplification cycles (denaturation: 95ºC, 15 s; annealing: 60°C, 30 s; elongation: 72°C, 35 s) on an ABI 7500 PCR Detection System (Applied Biosystems, USA). Melting curve and sequencing data were used to confirm the specificity of the PCR products. HO-1 mRNA levels were normalized to those of β-actin and subsequently expressed as values relative to the control using the comparative threshold cycle method.
5
Quantitative PCR Reactions Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Quantitative PCR reactions were performed using an ABI 7500 PCR Detection System (Applied Biosystems, United States). The qPCR reactions consisted of 10 μl of 2 × TransStartTM Green qPCR SuperMix, 1 μl of the cDNA template, 0.4 μl of passive reference dye, and 0.4 μl each of the forward and reverse primers (10 μM) in a 20-μl final volume. The RT-qPCR procedure was as follows: an initial cycle at 94°C (30 s), followed by 40 cycles of 5 s at 94°C and 34 s at 60°C. Following the RT-qPCR procedure, the consistency and the specificity of the PCR-amplified products were subjected to melting curve analysis for all reactions. The amplification efficiencies (E) and correlation coefficients (R2) were determined for each gene using the standard curves with a 5-fold dilution series of the template (1/2, 1/10, 1/50, 1/250, and 1/1,250), where R2 is the slope of the standard curve. E was calculated according to the equation E = (10[−1/slope] −1) × 100 (Michael and Pfaffl, 2001 (link)). Each reaction was performed in triplicate.
6
RNA Isolation and qRT-PCR Protocol
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
The RNAiso Plus kit (TaKaRa, Dalian, China) was used to isolate the total RNA from tissues and cells, and the RNA content was detected using a NanoDrop1000 spectrophotometer (Thermo Fisher Scientific, Wilmington, DE, USA). The RevertAid RT Reverse Transcription Kit (Thermo Fisher Scientific) was used to obtain the complementary DNA from the RNA, the qRT-PCR reactions were performed on the ABI 7500 PCR Detection System (Applied Biosystems, Foster City, CA, USA), and the fluorescent signal was SYBR Green I (Roche, Mannheim, Germany). All operations were performed according to the manufacturer's recommendations. The following are the primer sequences: cir-forward: 5′-ACTCCGTCACCTCGATTAGC-3′; cir-reverse: 5′-ATCATCCCATGTTCTCCGGC-3′; MUC1-forward: 5′-CGCCGAAAGAACTACGGGCAGCTG-3′; MUC1-reverse: 5′-CAAGTTGGCAGAAGTGGCTGCCAC-3′; glyceraldehyde-3-phosphate dehydrogenase (GAPDH)-forward: 5′-AATCCCATCACCATCTTCC-3′; GAPDH-reverse: 5′-CATCACGCCACAGTTTCC-3′; miR-forward: 5′-GGCTGGCCGTGATGAATTC-3′; miR-reverse: 5′-GCGAGCACAGAATTAATACGAC-3′; U6-forward: 5′-CTCGCTTCGGCAGCACA-3′; U6-reverse: 5′-AACGCTTCACGAATTTGCGT-3′. Sangon Biotech (Shanghai, China) was responsible for primer synthesis. The expression of the RNAs was evaluated by a relatively quantitative (2−ΔΔCt) method.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!