Dual luciferase detection kit

BAG5 was predicted to be a target gene of miR-142-5p based on analysis with TargetScan (http://www.targetscan.org, v7.2), which yielded a context++ score (The context++ score for a specific site is the sum of the contribution of a series of features). The 3'-untranslated region (3'UTR) of BAG5 was amplified via PCR from bovine mammary epithelial MAC-T cell cDNA and then inserted into the multiple cloning site downstream of the luciferase reporter gene in the pMIR-REPORT™ luciferase plasmid (Thermo Fisher Scientific, Inc.) to construct the luciferase reporter plasmid [BAG5 3'UTR wild-type (WT)]. MAC-T cells were transfected with 1 µg 3'UTR WT or mutant (MUT) constructed by chemical synthesis (General Biosystems Co., Ltd.) and 50 nM miR-142-5p mimics or miR-142-5p mimics NC using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Cells transfected BAG5 3'UTR WT or MUT plasmid served as blank group. After 24 h incubation at 37˚C, the cells were lysed by lysis buffer as supplied by the Dual-Luciferase Detection kit (Beyotime Institute of Biotechnology) on ice and luciferase activity was measured using a Dual-Lumi II Luciferase Reporter Gene Assay kit (Beyotime Institute of Biotechnology) according to the manufacturer's instructions. Firefly luciferase activities were normalized to Renilla luciferase activities.

Wild-type (WT) or mutant (MUT) versions of miR-129-5p were subcloned into the pGL3 Basic vector (Promega Corporation). A total of 20 nM miR-129-5p mimics (5'CUUUUUGCGUCUGGGCUUGC3') (Guangzhou RiboBio Co., Ltd.) were co-transfected with pLUC-WT-HMGB1 (5'UACCACUCUGUAAUUGCAAAAAA) or pLUC-MUT-HMGB1 (5'UACCACUCUGUAAUUCCUAUAUA) (500 ng) into 3x10⁴ A7r5 cells. Cells were transfected using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. After 48 h incubation at 37˚C, the cells were lysed by lysis buffer as supplied by the Dual-Luciferase Detection kit (Beyotime Institute of Biotechnology) on ice and luciferase activity was tested using the Dual-Luciferase Reporter assay system (Promega Corporation). Luciferase activity was normalized to Renilla luciferase activity. After transfection for 48 h, relative luminescence was tested using luminometry according to the manufacturer's instructions.