Log In Sign up
The largest database of trusted experimental protocols

Pcdh cmv mcs ef1 gfppuro

Manufactured by System Biosciences
Visit Supplier

The PCDH.CMV-MCS-EF1-GFPpuro is a plasmid vector designed for the expression of proteins in mammalian cells. It contains a cytomegalovirus (CMV) promoter for strong and constitutive expression, a multiple cloning site (MCS) for inserting the gene of interest, and an enhanced green fluorescent protein (GFP) and puromycin resistance genes for selection and monitoring of transfected cells.

Automatically generated - may contain errors

Lab products found in correlation

Ppack packaging plasmid mix, by System Biosciences (1 mentions) Pspax2, by Hanbio Biotechnology (1 mentions) Pmd2g, by Hanbio Biotechnology (1 mentions) Dulbecco modified eagle medium (dmem), by Thermo Fisher Scientific (1 mentions) Glutamax 1, by Thermo Fisher Scientific (1 mentions) Roswell park memorial institute (rpmi), by Thermo Fisher Scientific (1 mentions)

6 protocols using pcdh cmv mcs ef1 gfppuro

1

Lentiviral Transduction of HER2 Overexpression

Check if the same lab product or an alternative is used in the 5 most similar protocols
The plasmid pCMV6.Entry.hHER2 encoding human HER2 (hHER2; GeneBank accession no. NM_004448) was purchased from Origene (Rockville, MD) and a plasmid encoding canine HER2 (cHER2; GeneBank accession no. NP_001003217) was synthesized by Life Technologies. Both transgenes were subcloned into a pCDH expression lentiviral vector containing GFP reporter and puromycin resistance genes (pCDH.CMV-MCS-EF1-GFPpuro; System Biosciences, Mountain View, CA). VSV-G pseudotyped lentiviral particles were generated by transient transfection of 293T cells with the canine or human HER2 encoding pCDH lentiviral vector and pPACK packaging plasmid mix (System Biosciences). Transduced MDA-MB-468 cells were selected using 1ug/ml puromycin and grown in DMEM containing 10% heat-inactivated fetal calf serum and 1% GlutaMax.
Mata M., Vera J., Gerken C., Rooney C.M., Miller T., Pfent C., Wang L.L., Wilson-Robles H.M, & Gottschalk S. (2014). Towards immunotherapy with redirected T cells in a large animal model: Ex vivo activation, expansion, and genetic modification of canine T cells. Journal of immunotherapy (Hagerstown, Md. : 1997), 37(8), 407-415.
+ Open protocol
+ Expand
2

Cloning of Cyclin D1 cDNA into Lentiviral Vector

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cyclin D1 cDNA was amplified by PCR starting from JEKO-1 cDNA by using specific primers engineered to include specific restriction enzymes (EcoRI and BamHI) for subsequently cloning of the positive amplified sequence into the lentiviral vector pCDH-CMV-MCS-EF1-GFP+Puro (System Bioscience). Cloning procedure was performed with standard methodology. Primer sequences are the following: Forward: 5′ CGGAATTCATGGAACACCAGCTCCTGTGCTGCG 3′; Reverse: 5′ CGGGATCCTCAGATGTCCACGTCC CGCACGTCG 3′
Restelli V., Chilà R., Lupi M., Rinaldi A., Kwee I., Bertoni F., Damia G, & Carrassa L. (2015). Characterization of a mantle cell lymphoma cell line resistant to the Chk1 inhibitor PF-00477736. Oncotarget, 6(35), 37229-37240.
+ Open protocol
+ Expand
3

Lentiviral Delivery of Cec Protein

Check if the same lab product or an alternative is used in the 5 most similar protocols
Cec was inserted into a GFP tagged lentiviral vector, pCDH-CMV-MCS-EF1-GFP + Puro (System Biosciences, SBI) between SwaI and NotI in MCS to yield lenti-GFP-Cec plasmid. The empty lentiviral vector fused with GFP (lenti-GFP) was used as a negative control. Lentivirus was produced using pPACK lentivector packaging systems following the vendor’s instruction manual (SBI). The concentration of lentivirus was 1-2×1012 LP/ml (LP: lentiviral particle). For treatment groups, 5-10ul of lenti-GFP-Cec was injected directly into the primary tumor. For control groups, 5–10ul of lenti-GFP was injected directly into the primary tumor. The same amount of virus was administrated to each group per experiment.
Yu H.G., McLaughlin S., Newman M., Brundage K., Ammer A., Martin K, & Coad J. (2017). Altering calcium influx for selective destruction of breast tumor. BMC Cancer, 17, 169.
+ Open protocol
+ Expand
4

Lentiviral Transduction of TRAF6 in 293T Cells

Check if the same lab product or an alternative is used in the 5 most similar protocols
The psuper‐retro‐puro shTRAF6 recombinant lentivirus (psuper‐TR1 and psuper‐TR2) and the empty psuper‐retro‐puro shRNA lentivirus (psuper) were constructed by our laboratory according to our previous research.14 The recombinant plasmid or empty vector was transfected with packaging plasmids pIK (Invitrogen) into 293T cells. The opening reading frame (ORF) of the human TRAF6 gene was PCR amplified and inserted into the lentiviral expression vector pCDH‐CMV‐MCS‐EF1‐GFP‐Puro (System Biosciences). The recombinant plasmid pCDH‐3×Flag‐TRAF6 or pCDH‐3×Flag‐TRAF6 124mut and the empty pCDH, lentivirus plasmid pMD2.G, and psPAX2 (Hanbio Biotechnology) were co‐transfected in 293T cells at 90% confluence.14 Puromycin was used to select cells with a stable expression of psuper‐TR1, psuper‐TR2, psuper, pCDH‐3×Flag‐TRAF6, pCDH‐3×Flag‐TRAF6 124mut and pCDH.
Guangwei Z., Zhibin C., Qin W., Chunlin L., Penghang L., Ruofan H., Hui C., Hoffman R.M, & Jianxin Y. (2022). TRAF6 regulates the signaling pathway influencing colorectal cancer function through ubiquitination mechanisms. Cancer Science, 113(4), 1393-1405.
+ Open protocol
+ Expand
5

Generation and Characterization of Recombinant Cell Lines

Check if the same lab product or an alternative is used in the 5 most similar protocols
Blood samples were obtained from healthy subjects on a protocol approved by the Institutional Review Board of Baylor College of Medicine. The cell lines U373, U87, T98G, A431, 293T and Raji were purchased from the American Type Culture Collection (ATCC; Manassas, VA). SNT16 cells were kindly provided by Dr. Norio Shimizu (Tokyo Medical and Dental University, Tokyo, Japan). The generation of U373 cells expressing an enhanced green fluorescent protein firefly luciferase fusion gene (U373.eGFP.ffLuc) was previously reported [7 (link)]. To generate Raji cells expressing IL13Rα1 or IL13Rα2 we cloned cDNAs encoding IL13Rα1 or IL13Rα2 (Origene, Rockville, MD) into pCDH-CMVMCS-EF1-GFP+puro (System Bioscience, Mountainview, CA). Cloning was verified by sequencing (Seqwright, Houston, TX). Raji cells were transduced with VSVG-pseudotyped lentiviral vectors to generate Raji-GFP, Raji-IL13Rα1, and Raji-IL13Rα2. Cell lines were grown in RPMI or DMEM (Thermo Scientific HyClone, Waltham, MA; Lonza, Basel, Switzerland) with 10% fetal calf serum (FCS; HyClone, Logan, UT) and 2 mM GlutaMAX-I (Invitrogen, Carlsbad, CA).
Krebs S., Chow K.K., Yi Z., Rodriguez-Cruz T., Hegde M., Gerken C., Ahmed N, & Gottschalk S. (2014). T cells redirected to IL13Rα2 with IL13 mutein-CARs have antiglioma activity but also recognize IL13Rα1. Cytotherapy, 16(8), 1121-1131.
+ Open protocol
+ Expand
6

Lentiviral Vector Construct for RHPN2

Check if the same lab product or an alternative is used in the 5 most similar protocols
To generate a lentiviral expression vector, RHPN2 was amplified from the cDNAs of normal lung tissue with primers containing XbaI and EcoR I cutting sites and tagged with FLAG at C-terminus. The fragment was then ligated into lentiviral expression vector pCDH-CMV-MCS-EF1-GFP-Puro (System Biosciences). The shRNA sequences targeting RHPN2 were synthesized and annealed, and then was inserted into lentiviral-based shRNA vector with HpaI and XhoI restriction cutting sites. The RHPN2 shRNA sequences were as following:
Sense:5’-AACTGGCTTTGTCGAGAGTCGATTCTTCAAGAGAGAATCGACTCTCGACAAAGCCTTTTTTC-3’,
Anti-sense:5’-TCGAGAAAAAAGGCTTTGTCGAGAGTCGATTCTCTCTTGAAGA ATCGACTCTCGACAAAGCCAGTT-3’. The sequence of each construct was confirmed by Sanger sequencing.
Xiao D., He J., Guo Z., He H., Yang S., Huang L., Pan H, & He J. (2021). Rhophilin-2 Upregulates Glutamine Synthetase by Stabilizing c-Myc Protein and Confers Resistance to Glutamine Deprivation in Lung Cancer. Frontiers in Oncology, 10, 571384.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!