End repair mix

Library preparation was done similar to Blecher-Gonen et al. (41 (link)) with some changes. Briefly, Sonicated DNA was subjected to a 50 μl end repair reaction using 1 μl End repair mix (E6050L, NEB), cleaned by 1.8× Ampure XP beads, followed by a 50μl A-tail reaction using 2 μl Klenow fragment exo- (M0212L, NEB). The products were cleaned by 1.8× beads and were ligated by 2 μl quick ligase (M2200, NEB) to 0.75 μM illumina compatible forked indexed adapters. Ligation products were size selected by 0.7× PEG (considering the PEG in the ligation buffer) in order to remove free adaptors. 12–19 cycles of amplification were performed by PFU Ultra II Fusion DNA polymerase (600670, Agilent) with the following Primers:

P7 5′AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGAC 3′,

P5 5′ CAAGCAGAAGACGGCATACGAGAT 3′.

Amplified DNA was size selected for 300–700 bp fragments by taking the supernatant after using 0.5× beads (which removed fragments greater than 700 bp) followed by a 1.0× beads cleaning (which removed remaining primers and adapter dimers). The final quality of the library was assessed by Qubit and TapeStation. Libraries were pooled and sequenced on NextSeq (illumina) for 75 bp paired-end sequencing, generating 10M reads per each library.

Because of the small size of the roundworm, its genomic DNA was directly
amplified using MDA by BGI. WGA was performed using the REPLI-g Single Cell Kit
(Qiagen Inc., Valencia, CA, USA). The sample was first lysed with lysis buffer
from the kit, then the DNA was denatured with denaturation buffer for 10 minutes
at 65°C. Denaturation was stopped by the addition of neutralization buffer, then
a master mix containing buffer and DNA polymerase was added and the isothermal
amplification reaction proceeded for 8 hours at 30°C. Amplified DNA was kept at
–20°C for long-term storage.
The library was prepared as follows: 1.5 µg DNA was fragmented by
ultrasonication, then its quality was tested by gel electrophoresis. DNA was
end-repaired by combining with End Repair Mix (New England Biolabs Inc. Beverly,
MA, USA), and incubating at 20°C for 30 minutes. DNA was then purified with the
QIA quick PCR Purification Kit (Qiagen), after which A-Tailing Mix was added and
incubated at 37°C for 30 minutes. DNA was purified with QIA quick PCR
Purification Kit (Qiagen), then combined with 60 nmol adapter and 2 µL Ligation
Mix before incubating at 20°C for 15 minutes. Adapter-ligated DNA was recovered
from a 2% agarose gel and purified with the QIA quick Gel Extraction kit
(Qiagen).