The largest database of trusted experimental protocols

The Sc-229 is a laboratory equipment product offered by Santa Cruz Biotechnology. It is designed for use in various scientific research applications. The core function of the Sc-229 is to provide a reliable and consistent solution for researchers, but a detailed description cannot be provided while maintaining an unbiased and factual approach.

Automatically generated - may contain errors

6 protocols using sc 229

1

Immunofluorescent Localization of USF1 in Oocytes and Embryos

Check if the same lab product or an alternative is used in the 5 most similar protocols
Immunofluorescent staining was performed for USF1 protein localization in oocytes and embryos according to previously published protocols (Tripurani et al. 2011 (link)). After fixation, permeabilization and blocking, samples were probed with commercially available rabbit polyclonal anti-USF1 antibody [1:200 (v/v), Santa Cruz Biotechnology, sc229] and corresponding fluorescein isothiocyanate-conjugated secondary antibody [0.5% (w/v) F9887; Sigma-Aldrich, St. Louis, MO]. Immunostaining experiments were replicated four times using at least 10–12 oocytes/embryos per sample. Oocytes and embryos incubated without the primary USF1 antibodies were used as negative controls.
+ Open protocol
+ Expand
2

Protein-DNA Binding Assay for USF1

Check if the same lab product or an alternative is used in the 5 most similar protocols
Biotin-labeled probes are mixed with USF1-overexpressing nuclear protein extract (supershift lane is generated by adding the USF1 protein and USF1 antibody [sc-229; SantaCruz Biotech]) and allowed to incubate at room temperature for 20 min. DNA–protein bands were detected using the LightShift Chemiluminescent EMSA Kit (Thermo Fisher Scientific). The probes used for EMSA were N4bp2l1 Ebox2 and CATCTATCACATGGCCGGAG.
+ Open protocol
+ Expand
3

Characterizing USF1 Transcription Factor Binding

Check if the same lab product or an alternative is used in the 5 most similar protocols
The probes shown in Fig. 4A were synthesized by Thermo Scientific and biotin labeled. HEK293T cells were transfected with a USF1 expression vector driven by a CMV promoter. Nuclear protein was extracted 48 h post-transfection. The biotin-labeled probe was mixed with the USF1-overexpressing nuclear protein extract [super-shift lane was generated by adding the USF1 protein and USF1 antibody (sc-229, SantaCruz Biotech)] and allowed to incubate at room temperature for 20 min. For detection of the DNA-protein bands, we used the LightShift Chemiluminescent EMSA kit (Thermo Fisher Scientific). The wild-type (wt) and mutant (mut) probes for EMSA were as follows: Kbtbd11 Ebox (wt), TTTTCTCCACCCACGTGTAAATG and Kbtbd11 Ebox (mut), TTTTCTCCACCCAaaaGTAAATG.
+ Open protocol
+ Expand
4

ChIP-qPCR Analysis of FAK Promoter Regulation

Check if the same lab product or an alternative is used in the 5 most similar protocols
Briefly, cell extracts were prepared from crosslinked cells that were incubated with anti-DNMT3a (Abcam; ab13888), anti-HDAC1 (Abcam; ab7028) and anti-USF1 (Santa Cruz; sc-229) antibodies. The immune complexes were collected via protein A-agarose and washed thoroughly. The DNA present in the cell extracts and in the immunoprecipitants were purified and quantified by real-time qPCR. The sequences of the PCR primers for the FAK promoter were 5'-CGCACAGCTGGGATACACTTTA-3' and 5'-TCACCTCAGCGCAGAGCTCTA-3'.
+ Open protocol
+ Expand
5

Protein Extraction and Western Blot Analysis

Check if the same lab product or an alternative is used in the 5 most similar protocols
Total protein was extracted from cells following transfection using Laemmli buffer and subjected to western blot analysis as described earlier.29, 30 After electrophoresis, the separated proteins were transferred to PVDF membrane using wet method. The membranes were incubated with rabbit polyclonal antibody to USF‐1 (SC‐229; Santa Cruz Biotechnology). The bound antigen–antibody complex was detected by HRP conjugated secondary antibody (Santa Cruz Biotechnology) and the electrochemiluminescence plus western blot detection system (GE Healthcare UK Limited). The same membrane was used for β‐actin levels detected by anti‐β‐actin antibody (Sigma Chemical Company) as an internal loading control.
+ Open protocol
+ Expand
6

Immunofluorescent Localization of USF-1

Check if the same lab product or an alternative is used in the 5 most similar protocols
PC‐3 cells were cultured on Lab‐Tek chamber slides (Nunc Inc.) and 24 h after various treatments were fixed in buffered formalin. Non‐specific sites were blocked with 3% bovine serum albumin (BSA) in phosphate buffered saline (PBS) (pH 7.4) with 0.25% Tween 20 for 30 min. Slides were then incubated overnight at 4°C in primary rabbit polyclonal antibody to USF‐1 (SC‐229; Santa Cruz Biotechnology) that was diluted to 1:100 with the blocking buffer. After washes in PBS (pH 7.4) with 0.25% Tween 20 (3 times each for 15 min), the cells were exposed to secondary antibody, FITC‐conjugated anti‐rabbit IgG that was diluted to 1:1000 in blocking buffer. After three washes in PBS (pH 7.4) with 0.25% Tween 20 (3 times each for 15 min) and one wash in PBS for 15 min, the slides were mounted with aqueous mounting media using antifade and DAPI (4′,6‐diamidino‐2‐phenylindole) (VectaShield, Vector) and visualized using triple band pass filter in Nikon epifluorescence microscope.
+ Open protocol
+ Expand

About PubCompare

Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.

We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.

However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.

Ready to get started?

Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required

Sign up now

Revolutionizing how scientists
search and build protocols!