Disruption of the il17ra and traf6 genes in MH-S cells was carried out using the CRISPR/Cas9 method [48 (link)]. An individual sgRNA was designed for each gene (IL-17RA sgRNA: GCTCTGCACCCTCGAGGTAC); (TRAF6 sgRNA: ATTTGGGCACTTTACCGTCA). The sgRNAs were prepared using the EnGen sgRNA synthesis kit following the manufacturer’s protocol (New England BioLabs), and then associated with EnGen Spy Cas9 NLS protein (New England BioLabs) using the 4D-Nucleofector system (Lonza), in combination with the P3 Primary Cell 4D-Nucleofector X kit. After 48 h, the cells were cloned using a 96-well plate. il17ra and traf6 clones were validated by RT-qPCR.
Engen spy cas9 nls protein
Manufactured by New England Biolabs
The EnGen Spy Cas9 NLS protein is a recombinant Cas9 variant derived from Streptococcus pyogenes. It contains a nuclear localization signal (NLS) to facilitate its translocation into the cell nucleus. The core function of this protein is to serve as a programmable RNA-guided DNA endonuclease for genome editing applications.
Automatically generated - may contain errors
3 protocols using engen spy cas9 nls protein
1
CRISPR Knockout of il17ra and traf6 in MH-S Cells
2
CRISPR-Cas9 Genome Editing in B. manjavacas
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Sequences for vasa and mlh3 were extracted from the B. manjavacas whole genome assembly GCA_018683815.1. Potential sgRNA targets were identified using the CHOPCHOP online server (https://chopchop.cbu.uib.no ) [44 (link)] and selected to optimize GC content (40% to 60%) and the presence of microhomology flanking the Cas9-cutting site. The potential for off-target binding was examined by searching the genome of B. manjavacas for sequence identity to the prospective sgRNA sequences using BLAST. Candidates without other significant BLAST hits, particularly those approximately 10 bp upstream of PAM sites, were chosen as candidate sgRNA targets. The sgRNAs were synthesized following Schier’s Cas9 protocol [34 (link)]. The ssDNA repair template was synthesized as a custom oligo by IDT (Table 1 ). EnGen Spy Cas9 NLS protein (20 μM) was purchased from NEB. The injection mixture consisted of 600 ng/μl Cas9 protein, 300 ng/μl sgRNA, (3 μM ssDNA for knock-in), 100 ng/μl tetramethylrhodamine labelled dextran, and 1× NEB buffer r3.1 and was assembled at room temperature.
3
CRISPR-Cas9 Editing in Zebrafish
Check if the same lab product or an alternative is used in the 5 most similar protocols
+ Expand
Target sequences were ordered as crRNAs (Merck) based on previously published sequences (Wu et al., 2018) (Supplementary Table 1) and co-injected alongside tracrRNA (Merck) in equimolar ratios and EnGen®Spy Cas9 NLS protein (NEB) into 1-cell zebrafish embryos.
About PubCompare
Our mission is to provide scientists with the largest repository of trustworthy protocols and intelligent analytical tools, thereby offering them extensive information to design robust protocols aimed at minimizing the risk of failures.
We believe that the most crucial aspect is to grant scientists access to a wide range of reliable sources and new useful tools that surpass human capabilities.
However, we trust in allowing scientists to determine how to construct their own protocols based on this information, as they are the experts in their field.
Ready to get started?
Sign up for free.
Registration takes 20 seconds.
Available from any computer
No download required
Revolutionizing how scientists
search and build protocols!